Chinese Bulletin of Botany ›› 2025, Vol. 60 ›› Issue (4): 551-561.DOI: 10.11983/CBB24154 cstr: 32102.14.CBB24154
Special Issue: 虚拟专辑 | 干旱响应与适应 | 整合生物学期刊集群跨刊组建
• RESEARCH ARTICLES • Previous Articles Next Articles
Yuhan Liu1, Qijiang Cao1,*(
), Shihan Zhang1, Yihui Li1, Jing Wang1, Xiaomeng Tan1, Xiaoru Liu1, Xianling Wang2
Received:2024-10-13
Accepted:2025-01-20
Online:2025-07-10
Published:2025-01-21
Contact:
*E-mail: caojiang2010@126.com
Yuhan Liu, Qijiang Cao, Shihan Zhang, Yihui Li, Jing Wang, Xiaomeng Tan, Xiaoru Liu, Xianling Wang. Mechanism by which AtFTCD-L is Involved in the Root Response to Soil Compaction[J]. Chinese Bulletin of Botany, 2025, 60(4): 551-561.
| Gene name | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|
| AtActin 8 | ATTGTGTTGGACTCTGGTGAT | CTGCTGGAAAGTG- CTGAGGG |
| At2g20830 (AtFTCD-L) | ATGAGGCAGACCGTTGCT | GTTGGGTCCTTCTTGT |
Table 1 Primer sequences for qRT-PCR
| Gene name | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|
| AtActin 8 | ATTGTGTTGGACTCTGGTGAT | CTGCTGGAAAGTG- CTGAGGG |
| At2g20830 (AtFTCD-L) | ATGAGGCAGACCGTTGCT | GTTGGGTCCTTCTTGT |
Figure1 Expression patterns of AtFTCD-L in Arabidopsis thaliana (A) Seed germination; (B) Root; (C) Leaf; (D) Flower; (E) Seed; (F) Silique; (G) Seed and silique. SAM: Shoot apical meristem. The numbers in (A), (D), (F) indicate different development stages.
Figure 2 Expression of AtFTCD-L in Arabidopsis thaliana root tip in 1/2MS media and gradient agar media (A) GUS histological staining of the root tips of A. thaliana in 1/2MS media and gradient agar media; (B) Expression of AtFTCD-L in the roots of A. thaliana. **, and *** indicate significant differences at the 0.01, and 0.001 levels, respectively. Bars=20 μm
Figure 3 Root growth phenotypes and statistical analysis of the wild type (WT), mutant, overexpression (OE) and complementary (Comp) lines of Arabidopsis thaliana in gradient agar media (A) Root growth of the WT, mutant and complementary lines; (B) Statistical results of 7-day root length for figure (A); (C) Root growth of the WT and OE lines; (D) Statistical result of 7-day root length for figure (C). * P<0.05; ** P<0.01. Bars=5 mm
Figure 4 Comparison of the cell morphology of Arabidopsis thaliana root tips between the mutant and wild-type (WT) plants in high-compactness resistance media (A) Root growth of the mutant and WT lines in gradient agar media; (B) Statistical results of apical width of the root tip cells on the 7th day in figure (A); (C) Cell morphology of the root tips for mutant and WT in high-compactness resistance media (3%); (D) Statistical results of the root tip cell length of the mutant and WT plants on the 7th day in figure (A). * P<0.05. Bars=20 μm
Figure 5 Growth of the wild type (WT), mutant, and complementary (Comp) plants crossed with the PIN7-GFP marker line in compactness resistance medium Bar=5 mm
Figure 6 Growth of the wild type (WT) and mutant plants crossed with PIN1/3- and DR5-GFP marker lines in 1/2MS medium (A) Images of the WT and ftcd mutant plants crossed with PIN1 under fluorescence and bright field; (B) Images of the WT and ftcd mutant plants crossed with PIN3 under fluorescence and bright field; (C) Images of the WT and ftcd mutant plants crossed with DR5 under fluorescence and bright field. Bars=20 μm
Figure 7 Distribution of PIN7 tagged with GFP in the mutant and wild type (WT) plants (A)-(D) Fluorescence distribution and expression of PIN7-GFP in the mutant and WT plants (A and C for mutant, B and D for WT); (E), (F) FM4-64 in the mutant (E) and WT (F) plants crossed with PIN7-GFP. Bars=50 μm
| [1] | Adamowski M, Friml J (2015). PIN-dependent auxin transport: action, regulation, and evolution. Plant Cell 27, 20-32. |
| [2] | Akula NN, Abdelhakim L, Knazovický M, Ottosen CO, Rosenqvist E (2024). Plant responses to co-occurring heat and water deficit stress: a comparative study of tolerance mechanisms in old and modern wheat genotypes. Plant Physiol Biochem 210, 108595. |
| [3] |
Bakker PAHM, Pieterse CMJ, de Jonge R, Berendsen RL (2018). The soil-borne legacy. Cell 172, 1178-1180.
DOI PMID |
| [4] |
Baskin TI (2005). Anisotropic expansion of the plant cell wall. Annu Rev Cell Dev Biol 21, 203-222.
PMID |
| [5] |
Bengough AG, McKenzie BM, Hallett PD, Valentine TA (2011). Root elongation, water stress, and mechanical impedance: a review of limiting stresses and beneficial root tip traits. J Exp Bot 62, 59-68.
DOI PMID |
| [6] | Blilou I, Xu J, Wildwater M, Willemsen V, Paponov I, Friml J, Heidstra R, Aida M, Palme K, Scheres B (2005). The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature 433, 39-44. |
| [7] | Cao QJ, Zhang W, Liu XY, Li Y (2022). AtFTCD-L, a trans-Golgi network localized protein, modulates root grow- th of Arabidopsis in high-concentration agar culture medium. Planta 256, 3. |
| [8] |
Clark LJ, Whalley WR, Barraclough PB (2001). Partial mechanical impedance can increase the turgor of seedling pea roots. J Exp Bot 52, 167-171.
PMID |
| [9] | Dai YJ, Luo XF, Zhou WG, Chen F, Shuai HW, Yang WY, Shu K (2019). Plant systemic signaling under biotic and abiotic stresses conditions. Chin Bull Bot 54, 255-264. (in Chinese) |
|
代宇佳, 罗晓峰, 周文冠, 陈锋, 帅海威, 杨文钰, 舒凯 (2019). 生物和非生物逆境胁迫下的植物系统信号. 植物学报 54, 255-264.
DOI |
|
| [10] |
Dinneny JR, Long TA, Wang JY, Jung JW, Mace D, Pointer S, Barron C, Brady SM, Schiefelbein J, Benfey PN (2008). Cell identity mediates the response of Arabidopsis roots to abiotic stress. Science 320, 942-945.
DOI PMID |
| [11] |
Drakakaki G, Robert S, Szatmari AM, Brown MQ, Nagawa S, Van Damme D, Leonard M, Yang ZB, Girke T, Schmid SL, Russinova E, Friml J, Raikhel NV, Hicks GR (2011). Clusters of bioactive compounds target dynamic endomembrane networks in vivo. Proc Natl Acad Sci USA 108, 17850-17855.
DOI PMID |
| [12] | Gendre D, Oh J, Boutté Y, Best JG, Samuels L, Nilsson R, Uemura T, Marchant A, Bennett MJ, Grebe M, Bhalerao RP (2011). Conserved Arabidopsis ECHIDNA protein mediates trans-Golgi-network trafficking and cell elongation. Proc Natl Acad Sci USA 108, 8048-8053. |
| [13] | Gerttula S, Zinkgraf M, Muday GK, Lewis DR, Ibatullin FM, Brumer H, Hart F, Mansfield SD, Filkov V, Groover A (2015). Transcriptional and hormonal regulation of gravi- tropism of woody stems in Populus. Plant Cell 27, 2800-2813. |
| [14] |
Hawes M, Allen C, Turgeon BG, Curlango-Rivera G, Minh Tran T, Huskey DA, Xiong ZG (2016). Root border cells and their role in plant defense. Annu Rev Phytopathol 54, 143-161.
DOI PMID |
| [15] | Hu J, Su HL, Cao H, Wei HB, Fu XK, Jiang XM, Song Q, He XH, Xu CZ, Luo KM (2022). AUXIN RESPONSE FACTOR7 integrates gibberellin and auxin signaling via interactions between DELLA and AUX/IAA proteins to regulate cambial activity in poplar. Plant Cell 34, 2688-2707. |
| [16] |
Jin K, Shen JB, Ashton RW, Dodd IC, Parry MAJ, Whalley WR (2013). How do roots elongate in a structured soil? J Exp Bot 64, 4761-4777.
DOI PMID |
| [17] | Kolb E, Legué V, Bogeat-Triboulot MB (2017). Physical root-soil interactions. Phys Biol 14, 065004. |
| [18] |
Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25, 402-408.
DOI PMID |
| [19] |
Logemann E, Birkenbihl RP, Ülker B, Somssich IE (2006). An improved method for preparing Agrobacterium cells that simplifies the Arabidopsis transformation protocol. Plant Methods 2, 16.
DOI PMID |
| [20] | Luo J, Zhou JJ, Zhang JZ (2018). Aux/IAA gene family in plants: molecular structure, regulation, and function. Int J Mol Sci 19, 259. |
| [21] | Lynch JP, Brown KM (2012). New roots for agriculture: exploiting the root phenome. Philos Trans Roy Soc B: Biol Sci 367, 1598-1604. |
| [22] | Ma YR, Xu JH, Qi JH, Zhao D, Jin M, Wang T, Yang YF, Shi HJ, Guo L, Zhang H (2024). Crosstalk among plant hormone regulates the root development. Plant Signal Be- hav 19, 2404807. |
| [23] | Marhava P, Bassukas AEL, Zourelidou M, Kolb M, Moret B, Fastner A, Schulze WX, Cattaneo P, Hammes UZ, Schwechheimer C, Hardtke CS (2018). A molecular rheostat adjusts auxin flux to promote root protophloem differentiation. Nature 558, 297-300. |
| [24] | Okamoto T, Tsurumi S, Shibasaki K, Obana Y, Takaji H, Oono Y, Rahman A (2008). Genetic dissection of hormonal responses in the roots of Arabidopsis grown under continuous mechanical impedance. Plant Physiol 146, 1651-1662. |
| [25] | Pan JW, Ye D, Wang LL, Hua J, Zhao GF, Pan WH, Han N, Zhu MY (2004). Root border cell development is a temperature-insensitive and Al-sensitive process in barley. Plant Cell Physiol 45, 751-760. |
| [26] |
Petricka JJ, Winter CM, Benfey PN (2012). Control of Arabidopsis root development. Annu Rev Plant Biol 63, 563-590.
DOI PMID |
| [27] | Reiter WD (2008). Biochemical genetics of nucleotide sugar interconversion reactions. Curr Opin Plant Biol 11, 236-243. |
| [28] |
Sampedro J, Gianzo C, Iglesias N, Guitián E, Revilla G, Zarra I (2012). AtBGAL10 is the main xyloglucan β-galactosidase in Arabidopsis, and its absence results in unusual xyloglucan subunits and growth defects. Plant Physiol 158, 1146-1157.
DOI PMID |
| [29] |
Shekhar V, Stӧckle D, Thellmann M, Vermeer JEM (2019). The role of plant root systems in evolutionary adaptation. Curr Top Dev Biol 131, 55-80.
DOI PMID |
| [30] | Su NN, Zhu AQ, Tao X, Ding ZJ, Chang SH, Ye F, Zhang Y, Zhao C, Chen Q, Wang JQ, Zhou CY, Guo YR, Jiao SS, Zhang SF, Wen H, Ma LX, Ye S, Zheng SJ, Yang F, Wu S, Guo JT (2022). Structures and mechanisms of the Arabidopsis auxin transporter PIN3. Nature 609, 616-621. |
| [31] | Uchida K, Blumstein DT, Soga M (2024). Managing wildlife tolerance to humans for ecosystem goods and services. Trends Ecol Evol 39, 248-257. |
| [32] | Waadt R, Seller CA, Hsu PK, Takahashi Y, Munemasa S, Schroeder JI (2022). Plant hormone regulation of abiotic stress responses. Nat Rev Mol Cell Biol 23, 680-694. |
| [33] | Wang PF, Chen XS, Goldbeck C, Chung E, Kang BH (2017). A distinct class of vesicles derived from the trans- Golgi mediates secretion of xylogalacturonan in the root border cell. Plant J 92, 596-610. |
| [34] |
Whitmore AP, Whalley WR (2009). Physical effects of soil drying on roots and crop growth. J Exp Bot 60, 2845-2857.
DOI PMID |
| [35] |
Williams A, de Vries FT (2020). Plant root exudation under drought: implications for ecosystem functioning. New Phytol 225, 1899-1905.
DOI PMID |
| [36] | Xiong YW, Li XW, Wang TT, Gong Y, Zhang CM, Xing K, Qin S (2020). Root exudates-driven rhizosphere recruitment of the plant growth-promoting rhizobacterium Bacillus flexus KLBMP 4941 and its growth-promoting effect on the coastal halophyte Limonium sinense under salt stress. Ecotoxicol Environ Saf 194, 110374. |
| [37] |
Xu ED, Wu MY, Liu YY, Tai YP, Zha WJ, Gong CY, Zou Y, Zhang PJ, Zhang W, Chen X (2023). The Golgi-localized transporter OsPML3 is involved in manganese homeostasis and complex N-glycan synthesis in rice. J Exp Bot 74, 1853-1872.
DOI PMID |
| [38] | Yan X, Wang YT, Xu M, Dahhan DA, Liu C, Zhang Y, Lin JX, Bednarek SY, Pan JW (2021). Cross-talk between clathrin-dependent post-Golgi trafficking and clathrin-mediated endocytosis in Arabidopsis root cells. Plant Cell 33, 3057-3075. |
| [1] | Jixuan Yang, Xuefei Wang, Hongya Gu. Genetic Basis of Flowering Time Variations in Tibetan Arabidopsis thaliana [J]. Chinese Bulletin of Botany, 2024, 59(3): 373-382. |
| [2] | Yanxiao Chen, Yaping Li, Jinjun Zhou, Lixia Xie, Yongbin Peng, Wei Sun, Yanan He, onghui Jiang, Zenglan Wang, Chongke Zheng, Xianzhi Xie. Effect of Amino Acid Point Mutations on the Structure and Function of Phytochrome B in Arabidopsis thaliana [J]. Chinese Bulletin of Botany, 2024, 59(3): 481-494. |
| [3] | Gang Wang, Ertao Wang. The Broad-spectrum Innate Resistance Against Clubroot Disease Conferred by WeiTsing is Mechanistically Revealed [J]. Chinese Bulletin of Botany, 2023, 58(3): 356-358. |
| [4] | Yang Yongqing, Guo Yan. Analysis of the pH Sensing Mechanism of Plant Apoplasts [J]. Chinese Bulletin of Botany, 2022, 57(4): 409-411. |
| [5] | Tiantian Zhi, Zhou Zhou, Chengyun Han, Chunmei Ren. PAD4 Mutation Accelerating Programmed Cell Death in Arabidopsis thaliana Tyrosine Degradation Deficient Mutant sscd1 [J]. Chinese Bulletin of Botany, 2022, 57(3): 288-298. |
| [6] | Yanyan Li, Yanhua Qi. Advances in Biological Functions of Aux/IAA Gene Family in Plants [J]. Chinese Bulletin of Botany, 2022, 57(1): 30-41. |
| [7] | Yongmei Che, Yanjun Sun, Songchong Lu, Lixia Hou, Xinxin Fan, Xin Liu. AtMYB77 Involves in Lateral Root Development via Regulating Nitric Oxide Biosynthesis under Drought Stress in Arabidopsis thaliana [J]. Chinese Bulletin of Botany, 2021, 56(4): 404-413. |
| [8] | Ting Wang, Huanhuan Yang, Hongwei Zhao, Josef Voglmeir, Li Liu. Changes of Protein N-glycosylation in the Growth of Arabidopsis thaliana and Effects of Enzymatic Deglycosylation on Root Development [J]. Chinese Bulletin of Botany, 2021, 56(3): 262-274. |
| [9] | Yuqing Lin, Yanhua Qi. Advances in Auxin Efflux Carrier PIN Proteins [J]. Chinese Bulletin of Botany, 2021, 56(2): 151-165. |
| [10] | Long Ma, Guilin Li, Shipeng Li, Su Jiang. An Improved Protocol for Whole Mount Clearing of Plant Root Tip [J]. Chinese Bulletin of Botany, 2020, 55(5): 596-604. |
| [11] | Nan Zhang,Ziguang Liu,Shichen Sun,Shengyi Liu,Jianhui Lin,Yifang Peng,Xiaoxu Zhang,He Yang,Xi Cen,Juan Wu. Response of AtR8 lncRNA to Salt Stress and Its Regulation on Seed Germination in Arabidopsis [J]. Chinese Bulletin of Botany, 2020, 55(4): 421-429. |
| [12] | Fangfang He,Huize Chen,Jinlin Feng,Lin Gao,Jiao Niu,Rong Han. Response of Arabidopsis Cohesin RAD21 to Cell Division after Enhanced UV-B Radiation [J]. Chinese Bulletin of Botany, 2020, 55(4): 407-420. |
| [13] | Zeyuan Zuo,Wanlin Liu,Jie Xu. Evolution and Functional Analysis of Gene Clusters in Anther Tapetum Cells of Arabidopsis thaliana [J]. Chinese Bulletin of Botany, 2020, 55(2): 147-162. |
| [14] | Yuting Yao,Jiaqi Ma,Xiaoli Feng,Jianwei Pan,Chao Wang. A Role of Arabidopsis Phosphoinositide Kinase, FAB1, in Root Hair Growth [J]. Chinese Bulletin of Botany, 2020, 55(2): 126-136. |
| [15] | Wanyue Xu,Yingxiang Wang. Chromosome Behaviors of Male Meiocytes by Chromosome Spread in Arabidopsis thaliana [J]. Chinese Bulletin of Botany, 2019, 54(5): 620-624. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||