PAD4 Mutation Accelerating Programmed Cell Death in Arabidopsis thaliana Tyrosine Degradation Deficient Mutant sscd1

doi:10.11983/CBB21194

Abstract

Abstract: Programmed cell death (PCD) is extremely important for plant growth and defense. Fumarylacetoacetate hydrolase (FAH) deficient mutant short-day sensitive cell death 1 (sscd1) displayed PCD under short day condition (8 h light/16 h darkness). Our previous study found PCD in sscd1 was related to jasmonates (JAs) signal transduction but not to salicylic acid (SA). Phytoalexin deficient 4 (PAD4) is involved in mutual antagonism between SA and JAs signaling. In this study, PCD was accompanied by up-regulation of PAD4; while mutation of PAD4 accelerated the sscd1 PCD and induced JAs signaling pathway downstream response genes vegetative storage protein 2、thionin2.1 and defensin1.2. In triple mutant sscd1/pad4/coil, JAs signal transduction was blocked, resulting in the disappearance of PCD acceleration. PAD4 mutation induce the expression of Tyr degradation gene homogentisate dioxygenase and maleylacetoacetate isomerase, singlet oxygen specific induced genes bonzai1-associated protein 1 and a putative c2h2 zinc finger transcription factor in sscd1, the induction is dependent on JAs signaling receptor COI1. In conclusion, PAD4 mutation increase JAs signaling, then accelerate tyrosine degradation and singlet oxygen accumulation, thereby promoting PCD in the sscd1 mutant.

Key words: programmed cell death, PAD4, jasmonates signaling, tyrosine degradation, Arabidopsis thaliana

Tiantian Zhi, Zhou Zhou, Chengyun Han, Chunmei Ren. PAD4 Mutation Accelerating Programmed Cell Death in Arabidopsis thaliana Tyrosine Degradation Deficient Mutant sscd1[J]. Chinese Bulletin of Botany, 2022, 57(3): 288-298.

Add to citation manager EndNote|Ris|BibTeX

URL: https://www.chinbullbotany.com/EN/10.11983/CBB21194

https://www.chinbullbotany.com/EN/Y2022/V57/I3/288

Figures/Tables 7

Table 1 The primers used for qRT-PCR

Primer name	Primer sequence (5′-3′)
VSP2-F	GGATTGAACCCATCATACTCAG
VSP2-R	CACGAGACTCTTCCTCACCTTT
PDF1.2-F	GCTTCCATCATCACCCTTATC
PDF1.2-R	TTGGCTTCTCGCACAACTT
THI2.1-F	GTTGGGTAAACGCCATTCT
THI2.1-R	CATTGTTCCGACGCTCCATT
PAD4-F	GACGCTGCCATACTCAAACT
PAD4-R	CCAAAGGTGATACAAAAGACGC
BAP1-F	ATCGGATCCCACCAGAGATTACGG
BAP1-R	AATCTCGGCCTCCACAAACCAG
ZP-F	TACGAAGGAAAGAACGGAGGC
ZP-R	GGTATCGGCGGTATGTTGAGG
HGO-F	GGAGATTGATTTCGTTGATGGGTT
HGO-R	GCGGAGTCTTTCATTCCTGTGTTA
MAAI-F	GCTGGACTCTGCTACTGCGA
MAAI-R	AGGGCGATACGGACACGATG
ACTIN2-F	AGCACTTGCACCAAGCAGCATG
ACTIN2-R	ACGATTCCTGGACCTGCCTCATC

Figure 1 Programmed cell death (PCD) in Arabidopsis sscd1 mutant is accompanied by the up-regulation of PAD4 gene The values and error bars in the figure are means ± SE from three biological replicates, expression level in wild type (as control) was set to 1. * indicates significant difference at P<0.05, ** indicates significant difference at P<0.01 (Student’s t-test). WT: Wild type; SD: Short day

Figure 2 Mutation of PAD4 gene accelerated the programmed cell death (PCD) in Arabidopsis sscd1 mutant (A) The phenotype of wild type (WT) and mutant seedlings grown under short day (SD) for 6 d (bars=0.2 cm); (B) The rate of seedlings death in sscd1 and sscd1/pad4 seedlings grown under SD. The values and error bars in the figure are means ± SE from three biological replicates. * indicates significant difference at P<0.05 (Student’s t-test).

Figure 3 Relative expression level of jasmonates (JAs) responsive genes in Arabidopsis wild type (WT) and mutant seedlings The values and error bars in the figure are means ± SE from three biological replicates. * indicate significant differences at P<0.05 (Student’s t-test). WT: Wild type

Figure 4 The rate of seedlings death in Arabidopsis mutants The values and error bars in the figure are means ± SE from three biological replicates. * indicates significant difference at P<0.05 (Student’s t-test).

Figure 5 Relative expression level of Tyrosine (Tyr) degradation gene in Arabidopsis mutant seedlings The values and error bars in the figure are means ± SE from three biological replicates. * indicate significant differences at P<0.05 (Student’s t-test).

Figure 6 Relative expression level of singlet oxygen specific induced gene in Arabidopsis mutant seedlings The values and error bars in the figure are means ± SE from three biological replicates. * indicate significant differences at P<0.05 (Student’s t-test).

References 61

[1]	张宪省 (2018). 我国科学家在程序性细胞死亡机制研究领域取得重大突破. 植物学报 53, 445-446. DOI
[2]	赵曦娟, 钱礼超, 刘玉乐 (2018). 中国科学家在植物程序性细胞死亡领域取得重要成果. 植物学报 53, 447-450. DOI
[3]	Alvarez ME (2000). Salicylic acid in the machinery of hypersensitive cell death and disease resistance. Plant Mol Biol 44, 429-442. PMID
[4]	Asai T, Stone JM, Heard JE, Kovtun Y, Yorgey P, Sheen J, Ausubel FM (2000). Fumonisin B1-induced cell death in Arabidopsis protoplasts requires jasmonate-, ethylene-, and salicylate-dependent signaling pathways. Plant Cell 12, 1823-1835. PMID
[5]	Attaran E, Major IT, Cruz JA, Rosa BA, Koo AJK, Chen J, Kramer DM, He SY, Howe GA (2014). Temporal dynamics of growth and photosynthesis suppression in response to jasmonate signaling. Plant Physiol 165, 1302-1314. PMID
[6]	Benedetti CE, Xie D, Turner JG (1995). COI1-dependent expression of an Arabidopsis vegetative storage protein in flowers and siliques and in response to coronatine or methyl jasmonate. Plant Physiol 109, 567-572. PMID
[7]	Brodersen P, Malinovsky FG, Hématy K, Newman MA, Mundy J (2005). The role of salicylic acid in the induction of cell death in Arabidopsis acd11. Plant Physiol 138, 1037- 1045. PMID
[8]	Brodersen P, Petersen M, Nielsen HB, Zhu SJ, Newman MA, Shokat KM, Rietz S, Parker J, Mundy J (2006). Arabidopsis MAP kinase 4 regulates salicylic acid- and jasmonic acid/ethylene-dependent responses via EDS1 and PAD4. Plant J 47, 532-546. PMID
[9]	Campos ML, Kang JH, Howe GA (2014). Jasmonate-triggered plant immunity. J Chem Ecol 40, 657-675. DOI URL
[10]	Cohen S, Flescher E (2009). Methyl jasmonate: a plant stress hormone as an anti-cancer drug. Phytochemistry 70, 1600-1609. DOI URL
[11]	Cui HT, Gobbato E, Kracher B, Qiu JD, Bautor J, Parker JE (2017). A core function of EDS1 with PAD4 is to protect the salicylic acid defense sector in Arabidopsis immunity. New Phytol 213, 1802-1817. DOI URL
[12]	Cui HT, Qiu JD, Zhou Y, Bhandari DD, Zhao CH, Bautor J, Parker JE (2018). Antagonism of transcription factor MYC2 by EDS1/PAD4 complexes bolsters salicylic acid defense in Arabidopsis effector-triggered immunity. Mol Plant 11, 1053-1066. DOI URL
[13]	Daneva A, Gao Z, Van Durme M, Nowack MK (2016). Functions and regulation of programmed cell death in plant development. Annu Rev Cell Dev Biol 32, 441-468. PMID
[14]	Devoto A, Nieto-Rostro M, Xie DX, Ellis C, Harmston R, Patrick E, Davis J, Sherratt L, Coleman M, Turner JG (2002). COI1 links jasmonate signaling and fertility to the SCF ubiquitin-ligase complex in Arabidopsis. Plant J 32, 457-466. DOI URL
[15]	Dickman M, Williams B, Li YR, De Figueiredo P, Wolpert T (2017). Reassessing apoptosis in plants. Nat Plants 3, 773-779. DOI PMID
[16]	Dickman MB, Fluhr R (2013). Centrality of host cell death in plant-microbe interactions. Annu Rev Phytopathol 51, 543- 570. DOI PMID
[17]	Dixon DP, Edwards R (2006). Enzymes of tyrosine catabolism in Arabidopsis thaliana. Plant Sci 171, 360-366. DOI URL
[18]	Feys BJ, Moisan LJ, Newman MA, Parker JE (2001). Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. EMBO J 20, 5400-5411. PMID
[19]	Grompe M, Al-Dhalimy M, Finegold M, Ou CN, Burlingame T, Kennaway NG, Soriano P (1993). Loss of fumarylacetoacetate hydrolase is responsible for the neonatal hepatic dysfunction phenotype of lethal albino mice. Genes Dev 7, 2298-2307.
[20]	Gupta V, Willits MG, Glazebrook J (2000). Arabidopsis thaliana EDS4 contributes to salicylic acid (SA)-dependent expression of defense responses: evidence for inhibition of jasmonic acid signaling by SA. Mol Plant Microbe Interact 13, 503-511. DOI URL
[21]	Han CY, Ren CM, Zhi TT, Zhou Z, Liu Y, Chen F, Peng W, Xie DX (2013). Disruption of fumarylacetoacetate hydrolase causes spontaneous cell death under short-day conditions in Arabidopsis. Plant Physiol 162, 1956-1964. DOI URL
[22]	Hildebrandt TM, Nesi AN, Araújo WL, Braun HP (2015). Amino acid catabolism in plants. Mol Plant 8, 1563-1579. DOI PMID
[23]	Huysmans M, Buono RA, Skorzinski N, Radio MC, De Winter F, Parizot B, Mertens J, Karimi M, Fendrych M, Nowack MK (2018). NAC transcription factors ANAC087 and ANAC046 control distinct aspects of programmed cell death in the Arabidopsis Columella and lateral root cap. Plant Cell 30, 2197-2213. DOI URL
[24]	Huysmans M, Saul LA, Coll NS, Nowack MK (2017). Dying two deaths-programmed cell death regulation in development and disease. Curr Opin Plant Biol 35, 37-44. DOI PMID
[25]	Jirage D, Zhou N, Cooper B, Clarke JD, Dong XN, Glazebrook J (2001). Constitutive salicylic acid-dependent signaling in cpr1 and cpr6mutants requires PAD4. Plant J 26, 395-407. PMID
[26]	Jorquera R, Tanguay RM (2001). Fumarylacetoacetate, the metabolite accumulating in hereditary tyrosinemia, activates the ERK pathway and induces mitotic abnormalities and genomic instability. Hum Mol Genet 10, 1741-1752. DOI PMID
[27]	Kabbage M, Kessens R, Bartholomay LC, Williams B (2017). The life and death of a plant cell. Annu Rev Plant Biol 68, 375-404. DOI PMID
[28]	Katsir L, Chung HS, Koo AJK, Howe GA (2008). Jasmonate signaling: a conserved mechanism of hormone sensing. Curr Opin Plant Biol 11, 428-435. DOI PMID
[29]	Kurusu T, Kuchitsu K (2017). Autophagy, programmed cell death and reactive oxygen species in sexual reproduction in plants. J Plant Res 130, 491-499. DOI URL
[30]	Lindblad B, Lindstedt S, Steen G (1977). On the enzymic defects in hereditary tyrosinemia. Proc Natl Acad Sci USA 74, 4641-4645. DOI URL
[31]	Locato V, De Gara L (2018). Programmed cell death in plants: an overview. Methods Mol Biol 1743, 1-8.
[32]	Lock EA, Gaskin P, Ellis MK, Provan WM, Robinson M, Smith LL, Prisbylla MP, Mutter LC (1996). Tissue distribution of 2-(2-nitro-4-trifluoromethylbenzoyl) cyclohexane-1,3-dione (NTBC): effect on enzymes involved in tyrosine catabolism and relevance to ocular toxicity in the rat. Toxicol Appl Pharmacol 141, 439-447. DOI URL
[33]	Louis J, Gobbato E, Mondal HA, Feys BJ, Parker JE, Shah J (2012). Discrimination of Arabidopsis PAD4 activities in defense against green peach aphid and pathogens. Plant Physiol 158, 1860-1872. DOI PMID
[34]	Maekawa T, Kufer TA, Schulze-Lefert P (2011). NLR functions in plant and animal immune systems: so far and yet so close. Nat Immunol 12, 817-826. DOI PMID
[35]	Maizel A (2015). A view to a kill: markers for developmentally regulated cell death in plants. Plant Physiol 169, 2341. DOI URL
[36]	Mur LAJ, Kenton P, Atzorn R, Miersch O, Wasternack C (2006). The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol 140, 249-262. DOI URL
[37]	Olvera-Carrillo Y, Van Bel M, Van Hautegem T, Fendrych M, Huysmans M, Simaskova M, Van Durme M, Buscaill P, Rivas S, Coll NS, Coppens F, Maere S, Nowack MK (2015). A conserved core of programmed cell death indicator genes discriminates developmentally and environmentally induced programmed cell death in plants. Plant Physiol 169, 2684-2699. DOI PMID
[38]	Petrov V, Hille J, Mueller-Roeber B, Gechev TS (2015). ROS-mediated abiotic stress-induced programmed cell death in plants. Front Plant Sci 6, 69.
[39]	Rao MV, Lee HI, Creelman RA, Mullet JE, Davis KR (2000). Jasmonic acid signaling modulates ozone-induced hypersensitive cell death. Plant Cell 12, 1633-1646. PMID
[40]	Reape TJ, Molony EM, McCabe PF (2008). Programmed cell death in plants: distinguishing between different modes. J Exp Bot 59, 435-444. DOI URL
[41]	Reinbothe C, Springer A, Samol I, Reinbothe S (2009). Plant oxylipins: role of jasmonic acid during programmed cell death, defence and leaf senescence. FEBS J 276, 4666- 4681.
[42]	Repka V, Fischerová I, Šilhárová K (2004). Methyl jasmonate is a potent elicitor of multiple defense responses in grapevine leaves and cell-suspension cultures. Biol Plant 48, 273-283. DOI URL
[43]	Ruppert S, Kelsey G, Schedl A, Schmid E, Thies E, Schütz G (1992). Deficiency of an enzyme of tyrosine metabolism underlies altered gene expression in newborn liver of lethal albino mice. Genes Dev 6, 1430-1443. DOI URL
[44]	Russo PA, Mitchell GA, Tanguay RM (2001). Tyrosinemia: a review. Pediatr Dev Pathol 4, 212-221. DOI URL
[45]	Rustérucci C, Aviv DH, Holt III BF, Dangl JL, Parker JE (2001). The disease resistance signaling components EDS1 and PAD4 are essential regulators of the cell death pathway controlled by LSD1 in Arabidopsis. Plant Cell 13, 2211-2224. PMID
[46]	Schenck CA, Maeda HA (2018). Tyrosine biosynthesis, metabolism, and catabolism in plants. Phytochemistry 149, 82-102. DOI PMID
[47]	Sparnins VL, Chapman PJ (1976). Catabolism of L-tyrosine by the homoprotocatechuate pathway in gram-positive bac teria. J Bacteriol 127, 362-366. DOI PMID
[48]	St-Louis M, Tanguay RM (1997). Mutations in the fumarylacetoacetate hydrolase gene causing hereditary tyrosinemia type I: overview. Hum Mutat 9, 291-299. PMID
[49]	Van Hautegem T, Waters AJ, Goodrich J, Nowack MK (2015). Only in dying, life: programmed cell death during plant development. Trends Plant Sci 20, 102-113. DOI PMID
[50]	Vogelmann K, Drechsel G, Bergler J, Subert C, Philippar K, Soll J, Engelmann JC, Engelsdorf T, Voll LM, Hoth S (2012). Early senescence and cell death in Arabidopsis saul1 mutants involves the PAD4-dependent salicylic acid pathway. Plant Physiol 159, 1477-1487. DOI PMID
[51]	Xie DX, Feys BF, James S, Nieto-Rostro M, Turner JG (1998). COI1: an Arabidopsis gene required for jasmonate- regulated defense and fertility. Science 280, 1091-1094. PMID
[52]	Xu LH, Liu FQ, Lechner E, Genschik P, Crosby WL, Ma H, Peng W, Huang DF, Xie DX (2002). The SCF^COI1 ubiquitin-ligase complexes are required for jasmonate response in Arabidopsis. Plant Cell 14, 1919-1935. DOI URL
[53]	Yan JB, Zhang C, Gu M, Bai ZY, Zhang WG, Qi TC, Cheng ZW, Peng W, Luo HB, Nan FJ, Wang Z, Xie DX (2009). The Arabidopsis CORONATINE INSENSITIVE 1 protein is a jasmonate receptor. Plant Cell 21, 2220-2236. DOI URL
[54]	Yoon J, Chung WI, Choi D (2009). NbHB1, Nicotiana benthamiana homeobox 1, is a jasmonic acid-dependent positive regulator of pathogen-induced plant cell death. New Phytol 184, 71-84. DOI URL
[55]	Zeng HY, Liu Y, Chen DK, Bao HN, Huang LQ, Yin J, Chen YL, Xiao S, Yao N (2021). The immune components ENHANCED DISEASE SUSCEPTIBILITY 1 and PHYTOALEXIN DEFICIENT 4 are required for cell death caused by overaccumulation of ceramides in Arabidopsis. Plant J 107, 1447-1465. DOI URL
[56]	Zhang LR, Xing D (2008). Methyl jasmonate induces production of reactive oxygen species and alterations in mitochondrial dynamics that precede photosynthetic dysfunction and subsequent cell death. Plant Cell Physiol 49, 1092-1111. DOI URL
[57]	Zhi TT, Zhou Z, Huang Y, Han CY, Liu Y, Zhu Q, Ren CM (2016). Sugar suppresses cell death caused by disruption of fumarylacetoacetate hydrolase in Arabidopsis. Planta 244, 557-571. DOI URL
[58]	Zhi TT, Zhou Z, Qiu B, Zhu Q, Xiong XY, Ren CM (2019). Loss of fumarylacetoacetate hydrolase causes light-dependent increases in protochlorophyllide and cell death in Arabidopsis. Plant J 98, 622-638. DOI URL
[59]	Zhou LZ, Yang ZG, Zhi TT, Zhou Z, Wang XC, Ren CM, Qiu B (2016). A GC/MS method for determination of succinylacetone in Arabidopsis thaliana. Anal Bioanal Chem 408, 4661-4667. DOI URL
[60]	Zhou N, Tootle TL, Tsui F, Klessig DF, Glazebrook J (1998). PAD4 functions upstream from salicylic acid to control defense responses in Arabidopsis. Plant Cell 10, 1021-1030. PMID
[61]	Zhou Z, Zhi TT, Han CY, Peng ZH, Wang RZ, Tong JH, Zhu Q, Ren CM (2020). Cell death resulted from loss of fumarylacetoacetate hydrolase in Arabidopsis is related to phytohormone jasmonate but not salicylic acid. Sci Rep 10, 13714. DOI PMID