Evolution and Expression of NCED Family Genes in Vitis vinifera

doi:10.11983/CBB18200

Abstract

Abstract: 9-cis-epoxycarotenoid dioxygenase (NCED), a key rate-limiting enzyme in ABA biosynthesis in plants, is involved in plant drought, exogenous abscisic acid (ABA) and high salt response, and can reduce the damage of environmental stress on plants. With genome-wide identification and analysis of the grape NCED gene family, we aimed to understand the species evolution relationship and study the expression patterns of various genes in different tissues and under drought, ABA and high salt (NaCl) stress treatment, to lay the foundation for further study of the biological functions of NCED genes. A total of 12 NCED genes were found in the grape genome. The amino acid residues encoded by the genes are distributed between 510 aa (VvNCED2) and 625 aa (VvNCED10). The maximum molecular weight of the VvNCED protein was 70.53 kDa (VvNCED10) and the minimum was 57.85 kDa (VvNCED2). After differentiation from the ancestral gene, the grape NCED genes had five replication events with two loss events. The NCED1/2, NCED3/4, NCED6/7 and NCED9/10 gene pairs are thought to be produced by segmental duplication. The replication time of segmental duplication ranged from 3.08 to 120.0 million years ago, which is later than the differentiation of monocotyledons. As compared with the control, VvNCED1 was significantly upregulated by 72.1% after 48 h of ABA treatment, whereas VvNCED2 was significantly downregulated by 84.0%. The expression of VvNCED6 was higher in only roots under drought treatment for 14, 21 and 28 days than in the control: 2.49, 1.05 and 1.09 times of control values, respectively. The expression of VvNCED7 was only 1.07 times higher than the control value in roots under drought treatment for 14 days. After 72 h of ABA treatment, the expression of VvNCED3 was significantly downregulated by 59.5% as compared with the control, whereas VvNCED4 was significantly upregulated by 169.9% as compared with the control. The significant peaks in expression of VvNCED3/VvNCED4 after NaCl treatment were 24 and 48 h, respectively, up by 219.2% and 114.4%. The differential conserved-domain expression patterns with different stress treatments are the basis for the functional differentiation of NCED proteins. The functional differentiation of NCED during evolution may be conducive to the occurrence of replication events.

Key words: NCED gene family, grapevine, abiotic stress, gene expression

Xiaolong Wang,Fengzhi Liu,Xiangbin Shi,Xiaodi Wang,Xiaohao Ji,Zhiqiang Wang,Baoliang Wang,Xiaocui Zheng,Haibo Wang. Evolution and Expression of NCED Family Genes in Vitis vinifera[J]. Chinese Bulletin of Botany, 2019, 54(4): 474-485.

Add to citation manager EndNote|Ris|BibTeX

URL: https://www.chinbullbotany.com/EN/10.11983/CBB18200

https://www.chinbullbotany.com/EN/Y2019/V54/I4/474

Figures/Tables 9

Table 1 The primer sequences used for quantitative RT-PCR

Gene name	Forward primer (5'-3')	Reverse primer (5'-3')
VvNCED1	GCTGGAGAAGCTGATAGTGAAG	GAAGATACCCAATGACCGGAAG
VvNCED2	GGCACTTTCGGAGGTTGATAA	TGGATGAGCAGTGAAGGAATG
VvNCED3	CGGTGGAGATGGTGAGAATAGA	CACTGCTGCGTACACGTATTT
VvNCED4	CTCAGCAGTAGGTGATCCTTTG	CAGGCTCGTACATTCTCTTAGC
VvNCED6	CTCGTGATTTGGGCTCTTTCT	GCTTGATGATGTGTGCTTTGG
VvNCED7	CGCTCTTCTTCTTCCTCACTAC	GGCGTTCCCTCTTCTACTATTG
VvNCED9	CCATGGACTTCCCGATGATAAA	ATCCCACAACTAGAGCTTGC
VvNCED10	CAGGGAGGTGTTGAAGAAGATG	CCCTTTGAGGCAGTGTGATT
VvActin	TACAATTCCATCATGAAGTGTGATG	TTAGAAGCACTTCCTGTGAACAATG

Table 2 NCED genes identified in grapevine and their detailed information

Gene name	Accession No.	Chromosome location (start, end)	Length of amino acids (aa)	Molecular weight (kDa)	Theoretical pI	GRAVY
VvNCED1	VIT_213s0064g00840.1	Chr.13 (22672994, 22681910)	546	61.63	6.13	-0.271
VvNCED2	VIT_213s0064g00810.1	Chr.13 (22587965, 22596719)	510	57.85	6.23	-0.250
VvNCED3	VIT_202s0087g00910.1	Chr.2 (18560696, 18562591)	599	65.90	6.88	-0.236
VvNCED4	VIT_202s0087g00930.1	Chr.2 (18588853, 18590786)	589	65.61	6.63	-0.187
VvNCED5	VIT_216s0039g01370.1	Chr.16 (789473, 791221)	558	62.09	5.57	-0.197
VvNCED6	VIT_219s0093g00550.1	Chr.19 (17645348, 17647649)	609	67.13	6.38	-0.317
VvNCED7	VIT_210s0003g03750.1	Chr.10 (6374432, 6376728)	605	67.34	6.36	-0.365
VvNCED8	VIT_205s0051g00670.1	Chr.5 (11589343, 11591102)	575	63.14	8.24	-0.202
VvNCED9	VIT_204s0008g03510.1	Chr.4 (2883265, 2886523)	567	63.72	5.73	-0.335
VvNCED10	VIT_204s0008g03480.1	Chr.4 (2873553, 2878309)	625	70.53	6.43	-0.305
VvNCED11	VIT_204s0008g03380.1	Chr.4 (2784465, 2788790)	563	62.34	7.27	-0.339
VvNCED12	VIT_215s0021g02190.1	Chr.15 (13131078, 13135539)	610	68.46	7.31	-0.313

Figure 1 Joint phylogenetic tree (A) and amplification model (B) of NCED gene from grape, Arabidopsis and rice The red five-pointed stars in the figure represent the most recent common ancestral differentiation node before species differentiation. The numbers in the red and blue circles represent the number of duplication and loss events that occur after the species differentiated nodes, respectively. The numbers in the green solid box represent the number of NCED genes.

Figure 2 Phylogenetic relationship (A) and gene structure (B) of grape NCED genes

Figure 3 Schematic structure of conserved motifs identified in grapevine NCED proteins The grey bars represent the full length of NCED proteins, and the numbers in the other colored boxes are random numbers for the conserved domains located at NCED protein. The same number represents the same conserved domain.

Figure 4 Expression pattern of NCED genes at different developmental stages and in some specialized tissues of grapevine The 54 tissue names and gene names are located above and to the right of the heat map, respectively. The scale bar above the heat map indicates the geng expression level from 0.0 to 3.49.

Figure 5 Expression pattern of grapevine NCED genes under drought treatments The drought treatments (DL1-DL5 indicate drought treatment for 0, 7, 14, 21 and 28 days of leaf tissue, respectively; DR1-DR5 indicate drought treatment for 0, 7, 14, 21 and 28 days of root tissue, respectively) and gene names are located above and to the right of the heat map, respectively. The scale bar above the heat map indicates the gene expression level from 0.0 to 77.06. Solid dots of the same color represent duplicated gene pairs.

Figure 6 Expression pattern of grapevine NCED genes under ABA treatments Different lowercase letters above the histogram indicate significant differences among the different time points of the treatment (P<0.05).

Figure 7 Expression pattern of grapevine NCED genes under NaCl treatments Different lowercase letters above the histogram indicate significant differences among the different time points of the treatment (P<0.05).

References 24

[1]	白戈, 杨大海, 姚恒, 谢贺 ( 2017). 烟草NtNCED基因的鉴定分析. 分子植物育种 15, 3907-3912.
[2]	徐学中, 汪婷, 万旺, 李思慧, 朱国辉 ( 2018). 水稻ABA生物合成基因OsNCED3响应干旱胁迫. 作物学报 44, 24-31.
[3]	Adams KL, Cronn R, Percifield R, Wendel JF ( 2003). Genes duplicated by polyploidy show unequal contributions to the transcriptome and organ-specific reciprocal silencing. Proc Natl Acad Sci USA 100, 4649-4654.
[4]	Ahrazem O, Rubio-Moraga A, Trapero A, Gómez-Gómez L ( 2012). Developmental and stress regulation of gene expression for a 9-cis-epoxycarotenoid dioxygenase, Cst NCED, isolated from Crocus sativus stigmas. J Exp Bot 63, 681-694.
[5]	Chaw SM, Chang CC, Chen HL, Li WH ( 2004). Dating the monocot-dicot divergence and the origin of core eudicots using whole chloroplast genomes. J Mol Evol 58, 424-441.
[6]	Cohen-Gihon I, Sharan R, Nussinov R ( 2011). Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement. Phys Biol 8, 035009.
[7]	Fasoli M, Dal Santo S, Zenoni S, Tornielli GB, Farina L, Zamboni A, Porceddu A, Venturini L, Bicego M, Murino V, Ferrarini A, Delledonne M, Pezzotti M ( 2012). The grapevine expression atlas reveals a deep transcriptome shift driving the entire plant into a maturation program. Plant Cell 24, 3489-3505.
[8]	Gaut BS, Morton BR, McCaig BC, Clegg MT ( 1996). Substitution rate comparisons between grasses and palms: synonymous rate differences at the nuclear gene Adh parallel rate differences at the plastid gene rbcL. Proc Natl Acad Sci USA 93, 10274-10279.
[9]	Gu ZL, Nicolae D, Lu HHS, Li WH ( 2002). Rapid divergence in expression between duplicate genes inferred from microarray data. Trends Genet 18, 609-613.
[10]	Gu ZL, Rifkin SA, White KP, Li WH ( 2004). Duplicate genes increase gene expression diversity within and between species. Nat Genet 36, 577-579.
[11]	Guo CL, Guo RR, Xu XZ, Gao M, Li XQ, Song JY, Zheng Y, Wang XP ( 2014). Evolution and expression analysis of the grape (Vitis vinifera L.) WRKY gene family. J Exp Bot 65, 1513-1528.
[12]	Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyère C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pè ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quétier F, Wincker P ( 2007). The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449, 463-467.
[13]	Malacarne G, Perazzolli M, Cestaro A, Sterck L, Fontana P, Van de Peer Y, Viola R, Velasco R, Salamini F ( 2012). Deconstruction of the (Paleo) polyploid grapevine genome based on the analysis of transposition events involving NBS resistance genes. PLoS One 7, e29762.
[14]	McAdam SAM, Brodribb TJ ( 2015). The evolution of mechanisms driving the stomatal response to vapor pressure deficit. Plant Physiol 167, 833-843.
[15]	McAdam SAM, Brodribb TJ, Banks JA, Hedrich R, Atallah NM, Cai C, Geringer MA, Lind C, Nichols DS, Stachowski K, Geiger D, Sussmilch FC ( 2016). Abscisic acid controlled sex before transpiration in vascular plants. Proc Natl Acad Sci USA 113, 12862-12867.
[16]	Raghavendra AS, Gonugunta VK, Christmann A, Grill E ( 2010). ABA perception and signaling. Trends Plant Sci 15, 395-401.
[17]	Roychoudhury A, Paul S, Basu S ( 2013). Cross-talk between abscisic acid-dependent and abscisic acid-independent pathways during abiotic stress. Plant Cell Rep 32, 985-1006.
[18]	Saeed AI, Bhagabati NK, Braisted JC, Liang W, Sharov V, Howe EA, Li JW, Thiagarajan M, White JA, Quackenbush J ( 2006). TM4 microarray software suite. Methods Enzymol 411, 134-193.
[19]	Sussmilch FC, Brodribb TJ, McAdam SAM ( 2017). What are the evolutionary origins of stomatal responses to abscisic acid in land plants? J Integr Plant Biol 59, 240-260.
[20]	Tan BC, Joseph LM, Deng WT, Liu LJ, Li QB, Cline K, McCarty DR ( 2010). Molecular characterization of the Arabidopsis 9-cis epoxycarotenoid dioxygenase gene family. Plant J 35, 44-56.
[21]	Wang RY, Yang Y, Wang HG, Chen L, Wang L, Lu P, Liu MX, Qiao ZJ ( 2018). Cloning of gene PmNCED1 and its response to PEG stress in common millet. J Nuclear Agric Sci 32, 244-256.
[22]	Yang SH, Zhang XH, Yue JX, Tian DC, Chen JQ ( 2008). Recent duplications dominate NBS-encoding gene expan- sion in two woody species. Mol Genet Genom 280, 187-198.
[23]	Ye X, Kang BG, Osburn LD, Li Y, Cheng ZM ( 2009). Identification of the flavin-dependent monooxygenase- encoding YUCCA gene family in Populus trichocarpa and their expression in vegetative tissues and in response to hormone and environmental stresses. Plant Cell Tissue Organ Cult 97, 271-283.
[24]	Zhang JZ ( 2003). Evolution by gene duplication: an update. Trends Ecol Evol 18, 292-298.