Chin Bull Bot ›› 2018, Vol. 53 ›› Issue (5): 594-602.doi: 10.11983/CBB17114

• EXPERIMENTAL COMMUNICATIONS • Previous Articles     Next Articles

Cloning and Expression Pattern Analysis of Rice OsJMJ718 Alternative Polyadenylation Sequences During Reproductive Developmental Stage

Lu Dan, Wang Li, Song Fan, Tao Juhong, Zhang Dabing, Yuan Zheng*()   

  1. School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China
  • Received:2017-06-07 Accepted:2017-10-07 Online:2018-11-29 Published:2018-09-01
  • Contact: Yuan Zheng E-mail:zyuan@sjtu.edu.cn
  • About author:† These authors contributed equally to this paper

Abstract:

Alternative polyadenylation (APA) is one of the important regulatory pathways of eukaryotic gene expression. By forming different lengths of 3' untranslated regions, APA affects the stability, localization and translation efficiency of mRNA and increases the complexity of transcripts. The expression of the Arabidopsis gene increased polyadenylation of BONSAI methylation 1 (IBM1) is regulated by chromatin regulatory factor enhanced downy mildew 2 (EDM2), which can further affect the CHG methylation level of the Arabidopsis thaliana genome. However, whether such regulatory mechanisms exist in other species is unknown. To answer this question, we selected OsJMJ718, an IBM1 homologous gene of rice, for research. By using bioinformatics analysis and 3'RACE experiments, we found that homologous genes of IBM1 also had APA modification. Among them, the OsJMJ718 gene may have 9 alternative polyadenylation sequences. Further sequence alignment analysis revealed that the 3' terminal sequence of OsJMJ718 in the existing Japonica genome in the NCBI database may be different from that of the other ecotype genome sequences, such as 9522 and Minghui 63. Quantitative real-time PCR showed that the 9 transcripts of OsJMJ718 present diverse dynamic expression patterns in different stages of rice reproductive development. The expression of OsJMJ718-TVX5 was higher than that of other transcripts. In summary, this work provides information for APA sequences of OsJMJ718, and the expression pattern analysis of these transcripts would also help further study of the mechanism of APA and biological function of OsJMJ718.

Key words: rice, OsJMJ718, alternative polyadenylation, 3'RACE, expression pattern

Table 1

Primers used in this research"

Primer name Primer sequence (5′-3′) Type
qRT-F-TVX1 GAGCTTGGATAGCCCGCCTC qRT PCR
qRT-R-TVX1 TCTTTTCTTCCCGGGAGTGC qRT PCR
qRT-F-TVX2 CAATAATTGAACTCTAGGTC qRT PCR
qRT-R-TVX2 TAAGGAAATACAATCAGATC qRT PCR
qRT-F-TVX3 ACGGACGCTGGATCGGCGAG qRT PCR
qRT-R-TVX3 TAACAAGAGCAGTAGAGCAC qRT PCR
qRT-F-TVX4 ACGGACGCTGGATCGGCGAG qRT PCR
qRT-R-TVX4 AAGGACGGGGATGCGGCGT qRT PCR
qRT-F-TVX5 AACGACAACTTTAGGGTTCG qRT PCR
qRT-R-TVX5 TCGTTACAAGAAAGATGAAC qRT PCR
qRT-F-TVX6 ATCGAATTGCCACGTAAGCG qRT PCR
qRT-R-TVX6 TCATCCTCACTCTCTTCTTC qRT PCR
qRT-F-TVX7 GAACCACAGGGCCAAAGAAG qRT PCR
qRT-R-TVX7 TAATCCAATTAAAAGTGTTG qRT PCR
qRT-F-TVX9 AACTCTTCACCACGCGTATG qRT PCR
qRT-R-TVX9 TAACCGGCGATGGCTGCATC qRT PCR
qRT-F-TVX11 GAATAAGATGATAATCTATG qRT PCR
qRT-R-TVX11 ATATCTCTAACTCTACATGC qRT PCR
3'RACE-F-OsJMJ718 GATTACGCCAAGCTTAGTGAGACCAACAAGGGAGGTGCT 3'RACE

Figure 1

The number of alternative polyadenylation sequences of JHDM2 family genes in Arabidopsis thaliana and riceOs09g22540 (JMJ718) is OsJMJ718, the target sequence of this study; At3g07610 (JMJ25) is IBM1, which is the homo- logous gene of OsJMJ718 in Arabidopsis thaliana."

Figure 2

Sequence analysis of OsJMJ718-TVX transcriptsNine transcripts were named as TVX1-TVX9, respectively; Exon1-Exon10 represent common exon sequences for each transcript; Exon11-Exon18 were marked in different color, the 8 exons were processed in TVX1-TVX7 by alternative polyadenylation. However, 3’ terminal sequences of TVX8 and TVX9 are only exist in MH63 genomic sequences. * indicates stop codon"

Figure 3

Expression pattern analysis of OsJMJ718-TVX transcripts"

11 Saze H, Shiraishi A, Miura A, Kakutani T (2008). Control of genic DNA methylation by a jmjC domain-containing pro- tein in Arabidopsis thaliana. Science 319, 462-465.
12 Shen YJ, Venu RC, Nobuta K, Wu XH, Notibala V, Demirci C, Meyers BC, Wang GL, Ji GL, Li QQ (2011). Transcrip- tome dynamics through alternative polyadenylation in developmental and environmental responses in plants revealed by deep sequencing.Genome Res 21, 1478-1486.
13 Shi YS (2012). Alternative polyadenylation: new insights from global analyses.RNA 18, 2105-2117.
14 Simpson GG, Dijkwel PP, Quesada V, Henderson I, Dean C (2003). FY is an RNA 3′ end-processing factor that inter- acts with FCA to control the Arabidopsis floral transition.Cell 113, 777-787.
15 Sun Q, Zhou DX (2008). Rice jmjC domain-containing gene JMJ706 encodes H3K9 demethylase required for floral organ development. Proc Natl Acad Sci USA 105, 13679-13684.
16 Wu XH, Liu M, Downie B, Liang C, Ji GL, Li QQ, Hunt AG (2011). Genome-wide landscape of polyadenylation in Arabidopsis provides evidence for extensive alternative polyadenylation.Proc Natl Acad Sci USA 108, 12533-12538.
17 Xing DH, Li QQ (2011). Alternative polyadenylation and gene expression regulation in plants.Wiley Interdiscip Rev RNA 2, 445-458.
18 Yao P, Potdar AA, Arif A, Ray PS, Mukhopadhyay R, Willard B, Xu YC, Yan J, Saidel GM, Fox PL (2012). Coding region polyadenylation generates a truncated tRNA synthetase that counters translation repression.Cell 149, 88-100.
19 Zhang JX, Addepalli B, Yun KY, Hunt AG, Xu RQ, Rao S, Li QQ, Falcone DL (2008). A polyadenylation factor subunit implicated in regulating oxidative signaling in Ara- bidopsis thaliana. PLoS One 3, e2410.
20 Zhang JW, Chen LL, Xing F, Kudrna DA, Yao W, Copetti D, Mu T, Li WM, Song JM, Xie WB, Lee S, Talag J, Shao L, An Y, Zhang CL, Ouyang YD, Sun S, Jiao WB, Lv F, Du BG, Luo MZ, Maldonado CE, Goicoechea JL, Xiong LZ, Wu CY, Xing YZ, Zhou DX, Yu SB, Zhao Y, Wang GW, Yu Y, Luo YJ, Zhou ZW, Hurtado BEP, Danowitz A, Wing RA, Zhang QF (2016). Extensive sequence divergence between the reference genomes of two elite indica rice varieties Zhenshan 97 and Minghui 63. Proc Natl Acad Sci USA 113, E5163-E5171.
1 Elkon R, Ugalde AP, Agami R (2013). Alternative cleavage and polyadenylation: extent, regulation and function.Nat Rev Genet 14, 496-506.
2 Inagaki S, Miura-Kamio A, Nakamura Y, Lu FL, Cui X, Cao XF, Kimura H, Saze H, Kakutani T (2010). Autocatalytic differentiation of epigenetic modifications within the Ara- bidopsis genome.EMBO J 29, 3496-3506.
3 Itoh JI, Nonomura KI, Ikeda K, Yamaki S, Inukai Y, Yamagishi H, Kitano H, Nagato Y (2005). Rice plant development: from zygote to spikelet.Plant Cell Physiol 46, 23-47.
4 Lei MG, La HG, Lu K, Wang PC, Miki D, Ren ZZ, Duan CG, Wang XG, Tang K, Zeng L, Yang L, Zhang H, Nie WF, Liu P, Zhou JP, Liu RY, Zhong YL, Liu D, Zhu JK (2014). Arabidopsis EDM2 promotes IBM1 distal poly- adenylation and regulates genome DNA methylation pat- terns. Proc Natl Acad Sci USA 111, 527-532.
5 Licatalosi DD, Darnell RB (2010). RNA processing and its regulation: global insights into biological networks.Nat Rev Genet 11, 75-87.
6 Liu Y, Cui SJ, Wu F, Yan S, Lin XL, Du XQ, Chong K, Schilling S, Theissen G, Meng Z (2013). Functional conservation of MIKC*-type MADS box genes in Ara- bidopsis and rice pollen maturation.Plant Cell 25, 1288-1303.
7 Ma LY, Guo C, Li QQ (2014). Role of alternative poly- adenylation in epigenetic silencing and antisilencing.Proc Natl Acad Sci USA 111, 9-10.
8 Mayr C, Bartel DP (2009). Widespread shortening of 3'UTRs by alternative cleavage and polyadenylation activates onco- genes in cancer cells.Cell 138, 673-684.
9 Rigal M, Kevei Z, Pélissier T, Mathieu O (2012). DNA methylation in an intron of the IBM1 histone demethylase gene stabilizes chromatin modification patterns.EMBO J 31, 2981-2993.
10 Rosonina E, Manley JL (2010). Alternative polyadenylation blooms.Dev Cell 18, 172-174.
[1] yuchun Rao. Research Progress on Rice Root Genetics and Breeding [J]. Chin Bull Bot, 2020, 55(3): 0-0.
[2] Han Mei-ling, Tan Ru-jiao, Chao Dai-yin. A New Progress of Green Revolution: Epigenetic Modification Dual-regulated by Gibberellin and Nitrogen Supply Contributes to Breeding of High Yield and Nitrogen Use Efficiency Rice [J]. Chin Bull Bot, 2020, 55(1): 5-8.
[3] Zhang Tong,Guo Yalu,Chen Yue,Ma Jinjiao,Lan Jinping,Yan Gaowei,Liu Yuqing,Xu Shan,Li Liyun,Liu Guozhen,Dou Shijuan. Expression Characterization of Rice OsPR10A and Its Function in Response to Drought Stress [J]. Chin Bull Bot, 2019, 54(6): 711-722.
[4] Tian Huaidong, Li Jing, Tian Baohua, Niu Pengfei, Li Zhen, Yue Zhongxiao, Qu Yajuan, Jiang Jianfang, Wang Guangyuan, Cen Huihui, Li Nan, Yan Feng. Method for N-methyl-N-nitrosourea Mutagenesis on Hermaphroditic Germ Cells of Rice [J]. Chin Bull Bot, 2019, 54(5): 625-633.
[5] Zhou Chun, Jiao Ran, Hu Ping, Lin Han, Hu Juan, Xu Na, Wu Xianmei, Rao Yuchun, Wang Yuexing. Gene Mapping and Candidate Gene Analysis of Rice Early Senescence Mutant LS-es1 [J]. Chin Bull Bot, 2019, 54(5): 606-619.
[6] Zhang Shuo, Wu Changyin. Long Noncoding RNA Ef-cd Promotes Maturity Without Yield Penalty in Rice [J]. Chin Bull Bot, 2019, 54(5): 550-553.
[7] Li Weitao, He Min, Chen Xuewei. Discovery of ZmFBL41 Chang7-2 as A Key Weapon against Banded Leaf and Sheath Blight Resistance in Maize [J]. Chin Bull Bot, 2019, 54(5): 547-549.
[8] Cheng Xinjie, Yu Hengxiu, Cheng Zhukuan. Protocols for Analyzing Rice Meiotic Chromosomes [J]. Chin Bull Bot, 2019, 54(4): 503-508.
[9] Liu Dongfeng, Tang Yongyan, Luo Shengtao, Luo Wei, Li Zhitao, Chong Kang, Xu Yunyuan. Identification of Chilling Tolerance of Rice Seedlings by Cold Water Bath [J]. Chin Bull Bot, 2019, 54(4): 509-514.
[10] Liu Jin, Yao Xiaoyun, Yu Liqin, Li Hui, Zhou Huiying, Wang Jiayu, Li Maomao. Detection and Analysis of Dynamic Quantitative Trait Loci at Three Years for Seed Storability in Rice (Oryza sativa) [J]. Chin Bull Bot, 2019, 54(4): 464-473.
[11] Wang Xiaolin,Wang Ertao. NRT1.1B Connects Root Microbiota and Nitrogen Use in Rice [J]. Chin Bull Bot, 2019, 54(3): 285-287.
[12] Ye Wenlan,Ma Guolan,Yuan liyanan,Zheng Shiyi,Cheng Linqiao,Fang Yuan,Rao Yuchun. Research Progress on Pathogenic Characteristics and Resistance of Bacterial Panicle Blight of Rice [J]. Chin Bull Bot, 2019, 54(2): 277-283.
[13] Chen Lin,Lin Yan,Chen Pengfei,Wang Shaohua,Ding Yanfeng. Effect of Iron Deficiency on the Protein Profile of Rice (Oryza sativa) Phloem Sap [J]. Chin Bull Bot, 2019, 54(2): 194-207.
[14] Li Lulu, Yin Wenchao, Niu Mei, Meng Wenjing, Zhang Xiaoxing, Tong Hongning. Functional Analysis of Brassinosteroids in Salt Stress Responses in Rice [J]. Chin Bull Bot, 2019, 54(2): 185-193.
[15] Yang Dewei,Wang Mo,Han Libo,Tang Dingzhong,Li Shengping. Progress of Cloning and Breeding Application of Blast Resistance Genes in Rice and Avirulence Genes in Blast Fungi [J]. Chin Bull Bot, 2019, 54(2): 265-276.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
[1] Kang Le. The Chemical Defenses of plants to phytophagous Insects[J]. Chin Bull Bot, 1995, 12(04): 22 -27 .
[2] HUANG Kai-Yao;GUO Hou-Liang and YI Ping. Effects of Salt Stress on Cell Structure and N2 Fixation in Blue-Green Alga Anabaena cylindrica[J]. Chin Bull Bot, 1998, 15(03): 54 -56 .
[3] Zhang Jing-tan. Abbreviations for Some Commonly Used Term[J]. Chin Bull Bot, 1985, 3(01): 57 -58 .
[4] DU Gui-Sen;ZANG Yu-Long and WANG Mei-Zhi. Study on Spore Morphology of 6 Species of The Family Pottiaceae in China[J]. Chin Bull Bot, 1998, 15(03): 57 -60 .
[5] TIAN Xin-Zhi. On Plant Illustration and Artistic Drawing and Painting[J]. Chin Bull Bot, 1999, 16(04): 470 -476 .
[6] LI Xiu-Lan WU Cheng DENG Xiao-Jian YANG Zhi-Rong. Plant Height Genes and Their Progress of Molecular Biology Research in Rice[J]. Chin Bull Bot, 2003, 20(03): 264 -269 .
[7] LIU Hong-Tao LI Bing ZHOU Ren-Gang. Calcium_calmodulin Signal Transduction Pathway and Environment Stimulation[J]. Chin Bull Bot, 2001, 18(05): 554 -559 .
[8] Renyi Gui;Yadi Liu;Xiaoqin Guo;Haibao Ji;Yue Jia;Mingzeng Yu;Wei Fang*. Effects of Dose of 137Cs-γ Irradiation on Chlorophyll Fluorescence Parameters for Leaves of Seedlings of Phyllostachys heterocycla ‘Pubescens’[J]. Chin Bull Bot, 2010, 45(01): 66 -72 .
[9] Sanxiong Fu;Cunkou Qi*. Identification of Genes Differentially Expressed in Seeds of Brassica napus Planted in Nanjing and Lhasa by Arabidopsis Microarray[J]. Chin Bull Bot, 2009, 44(02): 178 -184 .
[10] Li Yunxiang, Liu Yucheng, Zhong Zhangcheng. Quantitative Structure and Dynamics of Leaf Populations of Gordonia acuminata on Jinyun Mountain[J]. Chin J Plan Ecolo, 1997, 21(1): 67 -76 .