Chin Bull Bot ›› 2018, Vol. 53 ›› Issue (5): 594-602.doi: 10.11983/CBB17114

• EXPERIMENTAL COMMUNICATIONS • Previous Articles     Next Articles

Cloning and Expression Pattern Analysis of Rice OsJMJ718 Alternative Polyadenylation Sequences During Reproductive Developmental Stage

Lu Dan, Wang Li, Song Fan, Tao Juhong, Zhang Dabing, Yuan Zheng*()   

  1. School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China
  • Received:2017-06-07 Accepted:2017-10-07 Online:2018-11-29 Published:2018-09-01
  • Contact: Yuan Zheng E-mail:zyuan@sjtu.edu.cn
  • About author:† These authors contributed equally to this paper

Abstract:

Alternative polyadenylation (APA) is one of the important regulatory pathways of eukaryotic gene expression. By forming different lengths of 3' untranslated regions, APA affects the stability, localization and translation efficiency of mRNA and increases the complexity of transcripts. The expression of the Arabidopsis gene increased polyadenylation of BONSAI methylation 1 (IBM1) is regulated by chromatin regulatory factor enhanced downy mildew 2 (EDM2), which can further affect the CHG methylation level of the Arabidopsis thaliana genome. However, whether such regulatory mechanisms exist in other species is unknown. To answer this question, we selected OsJMJ718, an IBM1 homologous gene of rice, for research. By using bioinformatics analysis and 3'RACE experiments, we found that homologous genes of IBM1 also had APA modification. Among them, the OsJMJ718 gene may have 9 alternative polyadenylation sequences. Further sequence alignment analysis revealed that the 3' terminal sequence of OsJMJ718 in the existing Japonica genome in the NCBI database may be different from that of the other ecotype genome sequences, such as 9522 and Minghui 63. Quantitative real-time PCR showed that the 9 transcripts of OsJMJ718 present diverse dynamic expression patterns in different stages of rice reproductive development. The expression of OsJMJ718-TVX5 was higher than that of other transcripts. In summary, this work provides information for APA sequences of OsJMJ718, and the expression pattern analysis of these transcripts would also help further study of the mechanism of APA and biological function of OsJMJ718.

Key words: rice, OsJMJ718, alternative polyadenylation, 3'RACE, expression pattern

Table 1

Primers used in this research"

Primer name Primer sequence (5′-3′) Type
qRT-F-TVX1 GAGCTTGGATAGCCCGCCTC qRT PCR
qRT-R-TVX1 TCTTTTCTTCCCGGGAGTGC qRT PCR
qRT-F-TVX2 CAATAATTGAACTCTAGGTC qRT PCR
qRT-R-TVX2 TAAGGAAATACAATCAGATC qRT PCR
qRT-F-TVX3 ACGGACGCTGGATCGGCGAG qRT PCR
qRT-R-TVX3 TAACAAGAGCAGTAGAGCAC qRT PCR
qRT-F-TVX4 ACGGACGCTGGATCGGCGAG qRT PCR
qRT-R-TVX4 AAGGACGGGGATGCGGCGT qRT PCR
qRT-F-TVX5 AACGACAACTTTAGGGTTCG qRT PCR
qRT-R-TVX5 TCGTTACAAGAAAGATGAAC qRT PCR
qRT-F-TVX6 ATCGAATTGCCACGTAAGCG qRT PCR
qRT-R-TVX6 TCATCCTCACTCTCTTCTTC qRT PCR
qRT-F-TVX7 GAACCACAGGGCCAAAGAAG qRT PCR
qRT-R-TVX7 TAATCCAATTAAAAGTGTTG qRT PCR
qRT-F-TVX9 AACTCTTCACCACGCGTATG qRT PCR
qRT-R-TVX9 TAACCGGCGATGGCTGCATC qRT PCR
qRT-F-TVX11 GAATAAGATGATAATCTATG qRT PCR
qRT-R-TVX11 ATATCTCTAACTCTACATGC qRT PCR
3'RACE-F-OsJMJ718 GATTACGCCAAGCTTAGTGAGACCAACAAGGGAGGTGCT 3'RACE

Figure 1

The number of alternative polyadenylation sequences of JHDM2 family genes in Arabidopsis thaliana and riceOs09g22540 (JMJ718) is OsJMJ718, the target sequence of this study; At3g07610 (JMJ25) is IBM1, which is the homo- logous gene of OsJMJ718 in Arabidopsis thaliana."

Figure 2

Sequence analysis of OsJMJ718-TVX transcriptsNine transcripts were named as TVX1-TVX9, respectively; Exon1-Exon10 represent common exon sequences for each transcript; Exon11-Exon18 were marked in different color, the 8 exons were processed in TVX1-TVX7 by alternative polyadenylation. However, 3’ terminal sequences of TVX8 and TVX9 are only exist in MH63 genomic sequences. * indicates stop codon"

Figure 3

Expression pattern analysis of OsJMJ718-TVX transcripts"

11 Saze H, Shiraishi A, Miura A, Kakutani T (2008). Control of genic DNA methylation by a jmjC domain-containing pro- tein in Arabidopsis thaliana. Science 319, 462-465.
12 Shen YJ, Venu RC, Nobuta K, Wu XH, Notibala V, Demirci C, Meyers BC, Wang GL, Ji GL, Li QQ (2011). Transcrip- tome dynamics through alternative polyadenylation in developmental and environmental responses in plants revealed by deep sequencing.Genome Res 21, 1478-1486.
13 Shi YS (2012). Alternative polyadenylation: new insights from global analyses.RNA 18, 2105-2117.
14 Simpson GG, Dijkwel PP, Quesada V, Henderson I, Dean C (2003). FY is an RNA 3′ end-processing factor that inter- acts with FCA to control the Arabidopsis floral transition.Cell 113, 777-787.
15 Sun Q, Zhou DX (2008). Rice jmjC domain-containing gene JMJ706 encodes H3K9 demethylase required for floral organ development. Proc Natl Acad Sci USA 105, 13679-13684.
16 Wu XH, Liu M, Downie B, Liang C, Ji GL, Li QQ, Hunt AG (2011). Genome-wide landscape of polyadenylation in Arabidopsis provides evidence for extensive alternative polyadenylation.Proc Natl Acad Sci USA 108, 12533-12538.
17 Xing DH, Li QQ (2011). Alternative polyadenylation and gene expression regulation in plants.Wiley Interdiscip Rev RNA 2, 445-458.
18 Yao P, Potdar AA, Arif A, Ray PS, Mukhopadhyay R, Willard B, Xu YC, Yan J, Saidel GM, Fox PL (2012). Coding region polyadenylation generates a truncated tRNA synthetase that counters translation repression.Cell 149, 88-100.
19 Zhang JX, Addepalli B, Yun KY, Hunt AG, Xu RQ, Rao S, Li QQ, Falcone DL (2008). A polyadenylation factor subunit implicated in regulating oxidative signaling in Ara- bidopsis thaliana. PLoS One 3, e2410.
20 Zhang JW, Chen LL, Xing F, Kudrna DA, Yao W, Copetti D, Mu T, Li WM, Song JM, Xie WB, Lee S, Talag J, Shao L, An Y, Zhang CL, Ouyang YD, Sun S, Jiao WB, Lv F, Du BG, Luo MZ, Maldonado CE, Goicoechea JL, Xiong LZ, Wu CY, Xing YZ, Zhou DX, Yu SB, Zhao Y, Wang GW, Yu Y, Luo YJ, Zhou ZW, Hurtado BEP, Danowitz A, Wing RA, Zhang QF (2016). Extensive sequence divergence between the reference genomes of two elite indica rice varieties Zhenshan 97 and Minghui 63. Proc Natl Acad Sci USA 113, E5163-E5171.
1 Elkon R, Ugalde AP, Agami R (2013). Alternative cleavage and polyadenylation: extent, regulation and function.Nat Rev Genet 14, 496-506.
2 Inagaki S, Miura-Kamio A, Nakamura Y, Lu FL, Cui X, Cao XF, Kimura H, Saze H, Kakutani T (2010). Autocatalytic differentiation of epigenetic modifications within the Ara- bidopsis genome.EMBO J 29, 3496-3506.
3 Itoh JI, Nonomura KI, Ikeda K, Yamaki S, Inukai Y, Yamagishi H, Kitano H, Nagato Y (2005). Rice plant development: from zygote to spikelet.Plant Cell Physiol 46, 23-47.
4 Lei MG, La HG, Lu K, Wang PC, Miki D, Ren ZZ, Duan CG, Wang XG, Tang K, Zeng L, Yang L, Zhang H, Nie WF, Liu P, Zhou JP, Liu RY, Zhong YL, Liu D, Zhu JK (2014). Arabidopsis EDM2 promotes IBM1 distal poly- adenylation and regulates genome DNA methylation pat- terns. Proc Natl Acad Sci USA 111, 527-532.
5 Licatalosi DD, Darnell RB (2010). RNA processing and its regulation: global insights into biological networks.Nat Rev Genet 11, 75-87.
6 Liu Y, Cui SJ, Wu F, Yan S, Lin XL, Du XQ, Chong K, Schilling S, Theissen G, Meng Z (2013). Functional conservation of MIKC*-type MADS box genes in Ara- bidopsis and rice pollen maturation.Plant Cell 25, 1288-1303.
7 Ma LY, Guo C, Li QQ (2014). Role of alternative poly- adenylation in epigenetic silencing and antisilencing.Proc Natl Acad Sci USA 111, 9-10.
8 Mayr C, Bartel DP (2009). Widespread shortening of 3'UTRs by alternative cleavage and polyadenylation activates onco- genes in cancer cells.Cell 138, 673-684.
9 Rigal M, Kevei Z, Pélissier T, Mathieu O (2012). DNA methylation in an intron of the IBM1 histone demethylase gene stabilizes chromatin modification patterns.EMBO J 31, 2981-2993.
10 Rosonina E, Manley JL (2010). Alternative polyadenylation blooms.Dev Cell 18, 172-174.
[1] Huai-Dong Tian. Method for N-methyl-N-nitrosourea Mutagenesis on Hermaphroditic Germ Cells of Rice [J]. Chin Bull Bot, 2019, 54(5): 0-0.
[2] yuchun Rao Chun Zhou Han Lin. Gene Mapping and Candidate Gene Analysis of Rice Early Senescence Mutant LS-es1 [J]. Chin Bull Bot, 2019, 54(5): 0-0.
[3] Jin -Liu Jia-Yu WANG. Detection and Analysis of Dynamic QTL at Three Year for Seed Storability in Rice (Oryza sativa) [J]. Chin Bull Bot, 2019, 54(4): 0-0.
[4] 徐 徐徐云远 chong chongkang. Identification of Chilling Tolerance of Rice Seedlings by Cold Water Bath [J]. Chin Bull Bot, 2019, 54(4): 0-0.
[5] Wang Xiaolin,Wang Ertao. NRT1.1B Connects Root Microbiota and Nitrogen Use in Rice [J]. Chin Bull Bot, 2019, 54(3): 285-287.
[6] Li Lulu,Yin Wenchao,Niu Mei,Meng Wenjing,Zhang Xiaoxing,Tong Hongning. Functional Analysis of Brassinosteroids in Salt Stress Responses in Rice [J]. Chin Bull Bot, 2019, 54(2): 185-193.
[7] Ye Wenlan,Ma Guolan,Yuan liyanan,Zheng Shiyi,Cheng Linqiao,Fang Yuan,Rao Yuchun. Research Progress on Pathogenic Characteristics and Resistance of Bacterial Panicle Blight of Rice [J]. Chin Bull Bot, 2019, 54(2): 277-283.
[8] Yang Dewei,Wang Mo,Han Libo,Tang Dingzhong,Li Shengping. Progress of Cloning and Breeding Application of Blast Resistance Genes in Rice and Avirulence Genes in Blast Fungi [J]. Chin Bull Bot, 2019, 54(2): 265-276.
[9] Chen Lin,Lin Yan,Chen Pengfei,Wang Shaohua,Ding Yanfeng. Effect of Iron Deficiency on the Protein Profile of Rice (Oryza sativa) Phloem Sap [J]. Chin Bull Bot, 2019, 54(2): 194-207.
[10] Xue Zhihui, Chong Kang. Chinese Scientists Make Groundbreaking Discoveries in Clonal Propagation of F1 Hybrids [J]. Chin Bull Bot, 2019, 54(1): 1-3.
[11] Zhu Li, Qian Qian. Astaxanthin Functional Rice: New Idea of Biofortification, New Perspectives for High-quality Rice Breeding [J]. Chin Bull Bot, 2019, 54(1): 4-8.
[12] Zhou Tingting, Rao Yuchun, Ren Deyong. Research Advances in the Cytological and Molecular Mechanisms of Leaf Rolling in Rice [J]. Chin Bull Bot, 2018, 53(6): 848-855.
[13] Liu Wei, Tong Yong’ao, Bai Jie. Bioinformatics Analysis of tRNA-derived Fragments in Rice Male Gametophyte Development [J]. Chin Bull Bot, 2018, 53(5): 625-633.
[14] Zhiping Song,Jiakuan Chen,Yao Zhao. Rice domestication and the Yangtze River civilization [J]. Biodiv Sci, 2018, 26(4): 346-356.
[15] Huang Xinyuan, Zhao Fangjie. A Defensin-like Protein Regulates Cadmium Accumulation in Rice [J]. Chin Bull Bot, 2018, 53(4): 451-455.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
[1] . [J]. Chin Bull Bot, 2006, 23(6): 730 .
[2] Xing Jian-min;Zha Li-hang;Li Zuo-hu;Liu Da-lu;Ye He-chun and Li Guo-feng. Advances in the Study on Taxol Production by Plant Cell Culture[J]. Chin Bull Bot, 1997, 14(03): 22 -29 .
[3] YU Xiao-Min ZHAO Gui-Fang. Microsporogenesis and Malegametogenesis of Larix chinensis Beissn[J]. Chin Bull Bot, 2003, 20(05): 576 -584 .
[4] . [J]. Chin Bull Bot, 1994, 11(专辑): 43 .
[5] WANG Fu-Qing LI Min QU Yong-Mei. Observation on Microstructure of Male Abortion in Chinese Cabbage[J]. Chin Bull Bot, 2001, 18(01): 105 -109 .
[6] Wang Xian-pu. The Role of Determining Key Speces of the Ecosystem in the Conservation and Utilization of the Biodiversity[J]. Chin Bull Bot, 1990, 7(04): 10 -12 .
[7] Shumei Ma, Rui Zhang, Yan Sun, Dongjun Liu, Yifan Guo, Wenlin Liu, Fengying Song, Shuping Yang, Jumei Zhang, Guangzu Sun, Hongji Zhang. Genetic Diversity of Wheat Germplasm Resources from Far East Russia and Heilongjiang Province[J]. Chin Bull Bot, 2014, 49(2): 150 -160 .
[8] Fei Yun-biao Huang Tao Shu Nian-hong Jiang Yong. Advances of Molecular Biology on Heat Shock Proteins[J]. Chin Bull Bot, 1995, 12(01): 1 -5 .
[9] Yang Hong-yuan and Zhou Chang. Experimental Reproductive Biology and Reproductive Cell Engineering of Plants: Now and Future[J]. Chin Bull Bot, 1989, 6(04): 193 -196 .
[10] Zhang Zhong-ming;Cui Ke-ming and Fan Yong-jun. Staining Plant Material Section With Toluiding Blue O Before Removal of Paraffin[J]. Chin Bull Bot, 1997, 14(02): 58 -60 .