Chin Bull Bot ›› 2018, Vol. 53 ›› Issue (1): 42-50.doi: 10.11983/CBB17058

• EXPERIMENTAL COMMUNICATIONS • Previous Articles     Next Articles

Histone Chaperone AtHIRA is Involved in Somatic Homologous Recombination and Salinity Response in Arabidopsis

Cheng Chen1,2, Aiwu Dong1,2, Wei Su1,2,*()   

  1. 1College of Life Sciences, Fudan University, Shanghai 200438, China
    2Department of Biochemistry, Fudan University, Shanghai 200438, China
  • Received:2017-03-22 Accepted:2017-08-30 Online:2018-08-10 Published:2018-01-01
  • Contact: Wei Su E-mail:weisu@fudan.edu.cn

Abstract:

Histone regulator (HIRA) is a specific chaperone for histone H3.3 and plays an important role in the incorporation of histone H3.3 into chromatin. HIRA is indispensable in mammalian embryo development and DNA damage repair process, but we have few studies of the function of an HIRA homolog in plants. Here, we studied the function of Arabidopsis thaliana AtHIRA in somatic homologous recombination (HR) and meiotic homologous recombination. We used the somatic HR system and the meiotic homologous recombination system in wild type and the hira-1 mutant, a loss- of-function mutant of AtHIRA. Both intramolecular and intermolecular HR frequency was lower in hira-1 than the wild type under normal growth conditions and under bleomycin or UV-C treatment, with no significant difference in the frequency of meiotic recombination of microsporocytes between the wild type and hira-1 mutant under normal growth conditions. As well, under normal growth conditions or bleomycin treatment, loss-of-function of AtHIRA in Arabidopsis did not affect the DNA damage level. On qRT-PCR, the expression of RAD51 and RAD54, two DNA repair-related genes, was higher in hira-1 than the wild type. In addition, hira-1 had a salt-sensitive phenotype as compared with the wild type under salt stress. AtHIRA may play a role in somatic HR and the salinity response in Arabidopsis.

Key words: HIRA, homologous recombination, DNA damage repair, meiotic, salt stress

Table 1

Primers used in this study"

Primer name Primer sequence (5′-3′)
ACTIN2-F GGCGATGAAGCTCAATCCAAA
ACTIN2-R GGTCACGACCAGCAAGATCAAG
GUS-F AAGTGGATTGATGTGATATCTC
GUS-R TTCGCGCTGATACCAGACG
ATM-F TGCAGCTGCGTCTCTGCATGA
ATM-R CTTCATGCCGCCCTTGGGCA
BRCA1-F TGCTCAGGGCTCACAGTTGAAGA
BRCA1-R TGCAGGCTCCGTTTTCATTGATTG
PARP1-F TGCTCGCGCGAACTCACTTCT
PARP1-R AGCCTCTCCACCAGAACGGCT
PARP2-F AGCCTGAAGGCCCGGGTAACA
PARP2-R GCTGTCTCAGTTTTGGCTGCCG
RAD51-F CGCCATTTCCCTCCACTCTCAAGC
RAD51-R ACCTGCTGCCTGAAGCTGTTCG
RAD54-F TGAGAGACAGGTGGGCACTCC
RAD54-R ACGTCACCTCGTCACCTGCTGA

Figure 1

hira1 mutant shows reduced homologus recombination frequency compared with Col-0 of Arabidopsis(A) Scheme of homologus recombination (HR) event in intramolecular line 1445. The two fragments of GUS gene can recombine to form a function GUS gene after a HR event; (B) Scheme of HR event in intermolecular line IC9C. The recombination of separated GUS fragments require intermolecular interaction to restore a functional GUS gene after a HR event; (C) Arabidopsis leaf with arrow labeled blue spots/sectors represent a functional GUS gene, which indicate an independent HR event (Bar=500 μm); (D) Comparison of intramolecular recombination frequency between Col-0 and hira-1; (E) Comparison of intermolecular recombination frequency between Col-0 and hira-1. WT: Wild type; HR: Homologus recombination. * P<0.05; ** P<0.01"

Figure 2

Effect of AtHIRA mutation on DNA damage level and expression level of DNA repair genes (means±SD)(A) Expression level of GUS gene in wild type and hira-1 mutant of Arabidopsis under normal conditions and bleomycin treatment; (B) Representative comet images of wild-type and hira-1 nuclei after bleomycin treatment (Bar=10 μm); (C) The average percentage of DNA in comet tails of wild type and hira-1 mutant. More than 100 individual nuclei were recorded and calculated; (D) Relative expression level of DNA repair genes by RT-qPCR between wild type and hira-1. Three biological repeats were analyzed."

Figure 3

Comparison of meiotic recombination frequency between wild type (WT) and hira-1 mutant of Arabidopsis using the fluorescent tagged line tetrad analysis system(A) Examples of tetrad fluorescent patterns including no cross over (NCO), two types of single cross overs (SCO-C-Y and SCO- Y-R) and one type of double cross over (DCO). The schematic representation of corresponding CO events is shown at right of each tetrad class (Bars=10 μm); (B) Number of each tetrad fluorescent patterns observed in wild type and hira-1."

Figure 4

Arabidopsis mutant hira-1 exhibited hypersensitivi- ty to salt stress (means±SD)(A) Phenotypes of 7-day-old seedlings of wild type (WT) and hira-1 grown on media containing 0, 50, 100, and 150 mmol·L-1 NaCl (Bar=1 cm); (B) Comparison of green cotyledon expansion rates of 7-day-old seedlings between wild type and hira-1. Over 100 seeds each genotype were recorded. Three biological repeats were analyzed."

[1] 夏志强, 何奕昆, 鲍时来, 种康 (2007). 植物开花的组蛋白甲基化调控分子机理. 植物学通报 24, 275-283.
[2] Amin AD, Vishnoi N, Prochasson P (2012). A global requirement for the HIR complex in the assembly of chromatin.Biochim Biophys Acta 1819, 264-276.
[3] Andersen SL, Sekelsky J (2010). Meiotic versus mitotic recombination: two different routes for double-strand b- reak repair: the different functions of meiotic versus mi- totic DSB repair are reflected in different pathway usage and different outcomes. Bioessays 32, 1058-1066.
[4] Francis KE, Lam SY, Harrison BD, Bey AL, Berchowitz LE, Copenhaver GP (2007). Pollen tetrad-based visual assay for meiotic recombination in Arabidopsis. Proc Natl Acad Sci USA 104, 3913-3918.
[5] Fritsch O, Benvenuto G, Bowler C, Molinier J, Hohn B (2004). The INO80 protein controls homologous recombination in Arabidopsis thaliana. Mol Cell 16, 479-485.
[6] Gao J, Zhu Y, Zhou WB, Molinier J, Dong AW, Shen WH (2012). NAP1 family histone chaperones are required for somatic homologous recombination in Arabidopsis.Plant Cell 24, 1437-1447.
[7] Gherbi H, Gallego ME, Jalut N, Lucht JM, Hohn B, White CI (2001). Homologous recombination in planta is stimulated in the absence of Rad50.EMBO Rep 2, 287-291.
[8] Giraut L, Falque M, Drouaud J, Pereira L, Martin OC, Mézard C (2011). Genome-wide crossover distribution in Arabidopsis thaliana meiosis reveals sex-specific patterns along chromosomes. PLoS Genet 7, e1002354.
[9] Heyer WD, Ehmsen KT, Liu J (2010). Regulation of homologous recombination in eukaryotes.Annu Rev Genet 44, 113-139.
[10] Ingouff M, Rademacher S, Holec S, Šoljić L, Xin N, Readshaw A, Foo SH, Lahouze B, Sprunck S, Berger F (2010). Zygotic resetting of the HISTONE 3 variant re- pertoire participates in epigenetic reprogramming in Arabi- dopsis.Curr Biol 20, 2137-2143.
[11] Krejci L, Altmannova V, Spirek M, Zhao XL (2012). Homologous recombination and its regulation.Nucleic Acids Res 40, 5795-5818.
[12] Loppin B, Bonnefoy E, Anselme C, Laurencon A, Karr TL, Couble P (2005). The histone H3.3 chaperone HIRA is essential for chromatin assembly in the male pronucleus.Nature 437, 1386-1390.
[13] Melamed-Bessudo C, Levy AA (2012). Deficiency in DNA methylation increases meiotic crossover rates in euchro- matic but not in heterochromatic regions in Arabidopsis.Proc Natl Acad Sci USA 109, E981-E988.
[14] Molinier J, Ries G, Bonhoeffer S, Hohn B (2004). Interchromatid and interhomolog recombination in Arabidopsis thaliana. Plant Cell 16, 342-352.
[15] Nie X, Wang HF, Li J, Holec S, Berger F (2014). The HIRA complex that deposits the histone H3.3 is conserved in Arabidopsis and facilitates transcriptional dynamics.Biol Open 3, 794-802.
[16] Okada T, Endo M, Singh MB, Bhalla PL (2005). Analysis of the histoneH3 gene family in Arabidopsis and identification of the male-gamete-specific variant AtMGH3. Plant J 44, 557-568.
[17] Otero S, Desvoyes B, Gutierrez C (2014). Histone H3 dynamics in plant cell cycle and development.Cytogenet Genome Res 143, 114-124.
[18] Roberts C, Sutherland HF, Farmer H, Kimber W, Halford S, Carey A, Brickman JM, Wynshaw-Boris A, Scambler PJ (2002). Targeted mutagenesis of theHira gene results in gastrulation defects and patterning abnormalities of mesoendodermal derivatives prior to early embryo- nic lethality. Mol Cell Biol 22, 2318-2328.
[19] Schuermann D, Fritsch O, Lucht JM, Hohn B (2009). Replication stress leads to genome instabilities in Arabidopsis DNA polymerase δ mutants.Plant Cell 21, 2700-2714.
[20] Schuermann D, Molinier J, Fritsch O, Hohn B (2005). The dual nature of homologous recombination in plants.Tren- ds Genet 21, 172-181.
[21] Sherwood PW, Osley MA (1991). Histone regulatory (hir) mutations suppress δ insertion alleles in Saccharomyces cerevisiae. Genetics 128, 729-738.
[22] Szenker E, Lacoste N, Almouzni G (2012). A developmental requirement for HIRA-dependent H3.3 deposition revealed at gastrulation in Xenopus. Cell Rep 1, 730-740.
[23] Tang Y, Poustovoitov MV, Zhao KH, Garfinkel M, Canu- tescu A, Dunbrack R, Adams PD, Marmorstein R (2006). Structure of a human ASF1a-HIRA complex and insights into specificity of histone chaperone complex assembly.Nat Struct Mol Biol 13, 921-929.
[24] Wijeratne AJ, Ma H (2007). Genetic analyses of meiotic recombination in Arabidopsis. J Integr Plant Biol 49, 1199-1207.
[25] Xu Y, Price BD (2011). Chromatin dynamics and the repair of DNA double strand breaks.Cell Cycle 10, 261-267.
[26] Zhu Y, Dong AW, Meyer D, Pichon O, Renou JP, Cao KW, Shen WH (2006). Arabidopsis NRP1 and NRP2 encode histone chaperones and are required for maintaining postembryonic root growth. Plant Cell 18, 2879-2892.
[1] Yu-Tao HUANG. Alleviation effects of exogenous salicylic?acid on seed germination of kale under salt stress and its physiological basis [J]. Chin Bull Bot, 2020, 55(1): 0-0.
[2] Li Lulu, Yin Wenchao, Niu Mei, Meng Wenjing, Zhang Xiaoxing, Tong Hongning. Functional Analysis of Brassinosteroids in Salt Stress Responses in Rice [J]. Chin Bull Bot, 2019, 54(2): 185-193.
[3] Shuhua Guo, Yongjiang Sun, Yanjie Niu, Ning Han, Heng Zhai, Yuanpeng Du. Effect of Alkaline Salt Stress on Photosystem Activity of Grape F1 Generation Hybrids [J]. Chin Bull Bot, 2018, 53(2): 196-202.
[4] Chen Xu, Xiaolong Liu, Qian Li, Fenglou Ling, Zhihai Wu, Zhian Zhang. Effect of Salt Stress on Photosynthesis and Chlorophyll Fluorescence Characteristics of Rice Leaf for Nitrogen Levels [J]. Chin Bull Bot, 2018, 53(2): 185-195.
[5] Baoling Liu, Li Zhang, Yan Sun,Jinai Xue, Changyong Gao, Lixia Yuan, Jiping Wang, Xiaoyun Jia, Runzhi Li. Genome-wide Characterization of bZIP Transcription Factors in Foxtail Millet and Their Expression Profiles in Response to Drought and Salt Stresses [J]. Chin Bull Bot, 2016, 51(4): 473-487.
[6] Qing-Xian KONG, Jiang-Bao XIA, Zi-Guo ZHAO, Fan-Zhu QU. Effects of groundwater salinity on the characteristics of leaf photosynthesis and stem sap flow in Tamarix chinensis [J]. Chin J Plan Ecolo, 2016, 40(12): 1298-1309.
[7] GUO Rui,LI Feng,ZHOU Ji,LI Hao-Ru,XIA Xu,LIU Qi. Eco-physiological responses of linseed (Linum usitatissimum) to salt and alkali stresses [J]. Chin J Plan Ecolo, 2016, 40(1): 69-79.
[8] Lin Qi, Xinfu Bai, Weihao Niu, Zhenhua Zhang. Effect of Rhizosphere Ventilation on Growth of Cotton Seedlings Under Salt Stress [J]. Chin Bull Bot, 2016, 51(1): 16-23.
[9] Qiong Jiang, Youning Wang, Lixiang Wang, Zhengxi Sun, Xia Li. Validation of Reference Genes for Quantitative RT-PCR Analysis in Soybean Root Tissue under Salt Stress [J]. Chin Bull Bot, 2015, 50(6): 754-764.
[10] MENG De-Yun,HOU Lin-Lin,YANG Sha,MENG Jing-Jing,GUO Feng,LI Xin-Guo,WAN Shu-Bo. Exogenous polyamines alleviating salt stress on peanuts (Arachis hypogaea) grown in pots [J]. Chin J Plan Ecolo, 2015, 39(12): 1209-1215.
[11] HU Chu-Qi,LIU Jin-Ke,WANG Tian-Hong,WANG Wen-Lin,LU Shan,ZHOU Chang-Fang. Influence of three types of salt stress on photosynthesis in Spartina alterniflora and Phragmites australis [J]. Chin J Plan Ecolo, 2015, 39(1): 92-103.
[12] Shasha Chen, Zhuanzhuan He, Shengxiu Jiang, Jiajia Xing, Xiuyun Lü, Haiyan Lan. Cloning and Expression Analysis of Calcium-dependent Phosphokinase Genes in Chenopodium album Under Stresses [J]. Chin Bull Bot, 2014, 49(2): 139-149.
[13] CHEN Jian, LI Ni-Ya, LIU Qiang, ZHONG Cai-Rong, HUANG Min, ZENG Jia. Antioxidant defense and photosynthesis for non-indigenous mangrove species Sonneratia apetala and Laguncularia racemosa under NaCl stress [J]. Chin J Plan Ecolo, 2013, 37(5): 443-453.
[14] CI Dun-Wei, DAI Liang-Xiang, SONG Wen-Wu, and ZHANG Zhi-Meng. Genotypic differences in salt tolerance from germination to seedling stage in peanut [J]. Chin J Plan Ecolo, 2013, 37(11): 1018-1027.
[15] Zhangxiong Han, Li Li, Xinwen Xu, Xiangfang Lü, Hongxia Yue, Zhen Bian, Lizheng Li. Effect of NaCl on Physiological Features of 4 Legume Seedlings in Desert Areas of Xinjiang, China [J]. Chin Bull Bot, 2012, 47(5): 491-499.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
[1] LIU Jun;ZHAO Lan-Yong;FENG Zhen;ZHANG Mei-Rong;WU Yin-Feng. Optimization Selection of Genetic Transformation Regeneration System from Leaves of Dendranthema morifolium[J]. Chin Bull Bot, 2004, 21(05): 556 -558 .
[2] Luo Jian-ping and Ja Jing-fen. Structure and Function of Plant Oligosaceaharins[J]. Chin Bull Bot, 1996, 13(04): 28 -33 .
[3] YANG Qi-He SONG Song-Quan YE Wan-HuiYIN Shou-HuaT. Mechanism of Seed Photosensitivity and FactorsInfluencing Seed Photosensitivity[J]. Chin Bull Bot, 2003, 20(02): 238 -247 .
[4] CUI Yue-Hua;WANG Mao and SUN Ke-Lian. Morphological Study of Gutta-containing Cells in Eucommia ulmoides Oliv.[J]. Chin Bull Bot, 1999, 16(04): 439 -443 .
[5] CHEN Shao-Liang LI Jin-Ke BI Wang-Fu WANG Sha-Sheng. Genotypic Variation in Accumulation of Salt Ions, Betaine and Sugars in Poplar Under Conditions of Salt Stress[J]. Chin Bull Bot, 2001, 18(05): 587 -596 .
[6] . Advances in Research into Low-Phytic-Acid Mutants in Crops[J]. Chin Bull Bot, 2005, 22(04): 463 -470 .
[7] Cong Ma, Weiwen Kong. Research Progress in Plant Metacaspase[J]. Chin Bull Bot, 2012, 47(5): 543 -549 .
[8] Chang’en Tian, Yuping Zhou. Research Progress in Plant IQ Motif-containing Calmodulin-binding Proteins[J]. Chin Bull Bot, 2013, 48(4): 447 -460 .
[9] Huawei Xu, Dianyun Hou. Research Advances in Protein Transport into Chloroplasts in Plant Cell#br#[J]. Chin Bull Bot, 2018, 53(2): 264 -275 .
[10] Li Jiandong, Zheng Huiying. ?ber die Anwendung der Braun-Blanquet's Methode in der Steppen-Untersuchung[J]. Chin J Plan Ecolo, 1983, 7(3): 186 -203 .