Genetic Analysis and Molecular Marker Development for the WTS135‒a Common Wheat-Thinopyrum ponticum Substitution Line with Leaf Rust Resistance

doi:10.11983/CBB25014

Abstract

Abstract: INTRODUCTION: The genetic diversity of common wheat (Triticum aestivum) has decreased sharply due to the domestication and modern breeding operations, making it more vulnerable to the threats from pests and pathogens. Leaf rust, caused by the fungal pathogen Puccinia triticina (Pt), is a devastating disease in wheat. Over 80 leaf rust resistance (Lr) genes have been identified, with nearly half originating from wheat wild relatives. However, the rapid evolution of Pt has rendered many Lr genes ineffective against prevalent Pt races. Consequently, identifying novel sources of resistance in wild relatives of common wheat remains an urgent priority for sustainable wheat breeding. RATIONALE: As one of the most widely used relatives in the genetic improvement of wheat, decaploid Thinopyrum ponticum shows excellent resistance to multiple diseases including leaf rust. By distant hybridization and chromosome engineering, we created a wheat-Th. ponticum line WTS135. We evaluated its disease resistance with Pt race THTT, developed Th. ponticum specific markers by specific-locus amplified fragment sequencing technology and assessed its agronomic traits by phenotypic investigation. Genomic in situ hybridization (GISH)-fluorescence in situ hybridization analysis (FISH) and liquid chip analysis have been used to identify its chromosome composition. RESULTS: WTS135 is immune to the Pt race THTT. Pedigree analysis showed that this resistance originated from the exogenous chromosome of Th. ponticum. GISH-FISH analysis revealed that the wheat chromosomes 7D were replaced by the Th. ponticum-derived chromosomes. Liquid chip analysis showed that the alien chromosomes belonged to the homoeologous group 7, and the density and abundance of the signals in the peri-centromeric region were significantly lower, which was consistent with the GISH results. Therefore, it is indicated that WTS135 is a 7St (7D) disomic substitution line. After detected by the molecular markers related to known Lr genes on wheat 7D chromosome, it is speculated that WTS135 probably carries a novel resistance gene that is different from genes Lr19 and Lr29. Ten primers specific to Th. ponticum were developed to rapidly trace the exogenous chromatin in WTS135. Phenotypic investigation showed that the yield of WTS135 was not significantly different from that of the recurrent parent Jimai 22, suggesting that this line can be useful for improving disease resistance in wheat. CONCLUSION: Introducing resistance genes from wild relatives into wheat through distant hybridization can broaden the genetic base of wheat and provide new sources for breeding disease-resistant varieties. We developed a common wheat-Th. ponticum 7St (7D) substitution line, which possibly has a novel alien resistance gene and could be used in the breeding for enhancing wheat disease resistance.

Chromosome composition and leaf rust resistance evaluation of WTS135. (A) GISH analysis using Thinopyrum ponticum gDNA as a probe and Chinese Spring gDNA as a block; (B) Mc-FISH analysis using combined oligo probes; (C) The liquid chip analysis of WTS135; (D) Evaluation for leaf rust resistance in WTS135 and its parents (1: WTS135; 2: Xiaoyan 81; 3: Jimai 22, 4: Zhongnong 28, 5: Th. ponticum). The white arrows indicate exogenous chromosomes, purple frames indicate chromosome additions or deletions.

Key words: wheat, Thinopyrum ponticum, leaf rust, distant hybridization, substitution line, in situ hybridization, molecular markers

Jia Gaiya, Zhang Na, Li Hongwei, Li Bin, Li Zhensheng, Kong Zhaosheng, Zheng Qi. Genetic Analysis and Molecular Marker Development for the WTS135‒a Common Wheat-Thinopyrum ponticum Substitution Line with Leaf Rust Resistance[J]. Chinese Bulletin of Botany, 2025, 60(5): 804-815.

Add to citation manager EndNote|Ris|BibTeX

URL: https://www.chinbullbotany.com/EN/10.11983/CBB25014

https://www.chinbullbotany.com/EN/Y2025/V60/I5/804

Figures/Tables 5

Figure 1 GISH, mc-FISH, and liquid chip analysis of WTS135 (A) GISH analysis using Thinopyrum ponticum gDNA as a probe and Chinese Spring gDNA as a block; (B) GISH analysis using Pseudoroegneria stipifolia gDNA as a probe and Th. elongatum gDNA as a block; (C) Mc-FISH analysis using combined oligo probes; (D) The liquid chip analysis of WTS135. The white arrows indicate exogenous chromosomes, purple frames indicate chromosome additions or deletions. Bars=20 μm.

Figure 2 Evaluation for leaf rust resistance in WTS135 and its parents, and agronomic traits of WTS135 and Jimai 22 (A) Evaluation for leaf rust resistance in WTS135 and its parents (1: WTS135; 2: Xiaoyan 81; 3: Jimai 22, 4: Zhongnong 28, 5: Thinopyrum ponticum); (B) Adult plants; (C) Front view of the main spike (WTS135 (right), Jimai 22 (left)); (D) Lateral view of the main spike (WTS135 (right), Jimai 22 (left)); (E) Matured seeds (WTS135 (right), Jimai 22 (left)).

Figure 3 Amplification results of 10 pairs of Thinopyrum ponticum-specific primers (A) and the results of molecular marker detection of Lr19 and Lr29 (B) M: Marker; 1: Thinopyrum ponticum; 2: Xiaoyan 81; 3: Jimai 22; 4: Zhongnong 28; 5: WTS135

Table 1 Thinopyrum ponticum-specific primers in WTS135

Primer name	Primer sequence (5ʹ→3ʹ)	Fragment size (bp)	Annealing temperature (°C)
Thp32	F: TTGCAGCAGATCGAATCAAG R: CCTTCTTTCCCCGTTACTGTT	237	51
Thp39	F: GCATCATCTGCATTGTCGTC R: TCTGCACATGATACCCCAGA	290	52
Thp40	F: GACCATGTAGGTGCAACGTG R: AATCACAAAGCCCCTCCTTT	270	52
Thp94	F: CCAAACCAACAAGCACATTG R: AGCACCTTTTGGATGACTGC	285	51
Thp115	F: ACAAGCAGACGACAATGCAA R: TGAGTATTTCGAGGGTTGTGG	220	52
Thp124	F: AGGCTGGATGACCGAGTATG R: GATCCAGTCGTGGAAGGTGT	295	55
Thp242	F: CTGCATGAGCAGAGTCTGGA R: GAACTCCATTCACAGCAGCA	290	54
Thp251	F: TTTTCTTTGCTGCCTTCGTT R: GCTTGTGGTGAAGCAAATCA	260	51
Thp328	F: ATTTTCGCCACTCGTCATTC R: CTCTTGAAGGGGTCCAGACA	270	51
Thp374	F: GCCCAGCAGACAGGTAAGTT R: CAGTGACGAACATCCCCTTT	255	53

Table 2 Comparison of agronomic traits between WTS135 and Jimai 22

Traits	Jimai 22	WTS135
Plant height (cm)	69.00±3.00	82.25±1.26**
Effective tiller number	13.33±1.53	23.75±1.71**
Spike length (cm)	8.80±0.56	8.83±0.57
Spikelet number per spike	20.67±0.58	19.50±1.00
Kernel number per spikelet	43.67±2.89	47.50±3.87
Total kernel number	517.33±62.05	755.75±15.17**
Yield per plant (g)	21.56±2.66	22.73±0.50
Thousand-kernel weight (g)	41.67±1.12**	30.07±0.11

References 49

[1]	Deng PC, Du X, Wang YZ, Yang XY, Cheng XF, Huang CX, Li TT, Li TD, Chen CH, Zhao JX, Wang CY, Liu XL, Tian ZR, Ji WQ (2024). GenoBaits^®WheatplusEE: a targeted capture sequencing panel for quick and accurate identification of wheat-Thinopyrum derivatives. Theor Appl Genet 137, 36.
[2]	Duan ZY, Xu XY, Li X, Li ZF, Ma J, Yao ZJ (2021). Leaf rust resistance gene analysis of 12 wheat cultivars in main producing areas. Crops 37(5), 20-27. (in Chinese)
	段振盈, 徐新玉, 李星, 李在峰, 马骏, 姚占军 (2021). 12个主产区历史小麦品种抗叶锈病基因分析. 作物杂志 37(5), 20-27.
[3]	Friebe B, Jiang J, Gill BS, Dyck PL (1993). Radiation- induced nonhomoeologous wheat-Agropyron intermedium chromosomal translocations conferring resistance to leaf rust. Theor Appl Genet 86, 141-149. DOI PMID
[4]	Friebe B, Jiang J, Raupp WJ, McIntosh RA, Gill BS (1996). Characterization of wheat-alien translocations conferring resistance to diseases and pests: current status. Euphytica 91, 59-87.
[5]	Fu SL, Lv ZL, Qi B, Guo X, Li J, Liu B, Han FP (2012). Molecular cytogenetic characterization of wheat-Thinopyrum elongatum addition, substitution and translocation lines with a novel source of resistance to wheat Fusarium Head Blight. J Genet Genomics 39, 103-110.
[6]	Gupta SK, Charpe A, Prabhu KV, Haque QMR (2006). Identification and validation of molecular markers linked to the leaf rust resistance gene Lr19 in wheat. Theor Appl Genet 113, 1027-1036.
[7]	Han FP, Lamb JC, Birchler JA (2006). High frequency of centromere inactivation resulting in stable dicentric chromosomes of maize. Proc Natl Acad Sci USA 103, 3238-3243. DOI PMID
[8]	He ZL, Zhang HK, Gao SH, Lercher MJ, Chen WH, Hu SN (2016). Evolview v2: an online visualization and management tool for customized and annotated phylogenetic trees. Nucleic Acids Res 44, W236-W241.
[9]	Huang XY, Zhu MQ, Zhuang LF, Zhang SY, Wang JJ, Chen XJ, Wang DR, Chen JY, Bao YG, Guo J, Zhang JL, Feng YG, Chu CG, Du P, Qi ZJ, Wang HG, Chen PD (2018). Structural chromosome rearrangements and polymorphisms identified in Chinese wheat cultivars by high- resolution multiplex oligonucleotide FISH. Theor Appl Genet 131, 1967-1986.
[10]	Ibba MI, Gupta OP, Govindan V, Johnson AAT, Brinch- Pedersen H, Nikolic M, Taleon V (2022). Editorial: wheat biofortification to alleviate global malnutrition. Front Nutr 9, 1001443.
[11]	Jiang J, Friebe B, Gill BS (1994). Chromosome painting of Amigo wheat. Theor Appl Genet 89, 811-813. DOI PMID
[12]	Knott DR (1968). Translocations involving Triticum chromosomes and Agropyron chromosomes carrying rust resistance. Can J Genet Cytol 10, 695-696.
[13]	Leng YK, Sun K, Chen XY, Li WW (2015). Suspension arrays based on nanoparticle-encoded microspheres for high-throughput multiplexed detection. Chem Soc Rev 44, 5552-5595. DOI PMID
[14]	Li JB, Guan HX, Wang YQ, Dong CM, Trethowan R, McIntosh RA, Zhang P (2024). Cytological and molecular characterization of wheat lines carrying leaf rust and stem rust resistance genes Lr24 and Sr24. Sci Rep 14, 12816.
[15]	Li MZ, Wang YZ, Liu XJ, Li XF, Wang HG, Bao YG (2021). Molecular cytogenetic identification of a novel wheat- Thinopyrum ponticum 1J^S (1B) substitution line resistant to powdery mildew and leaf rust. Front Plant Sci 12, 727734.
[16]	Li ZS, Li B, Tong YP (2008). The contribution of distant hybridization with decaploid Agropyron elongatum to wheat improvement in China. J Genet Genomics 35, 451-456.
[17]	Lin GF, Chen H, Tian B, Sehgal SK, Singh L, Xie JZ, Rawat N, Juliana P, Singh N, Shrestha S, Wilson DL, Shult H, Lee H, Schoen AW, Tiwari VK, Singh RP, Guttieri MJ, Trick HN, Poland J, Bowden RL, Bai GH, Gill B, Liu SZ (2022). Cloning of the broadly effective wheat leaf rust resistance gene Lr42 transferred from Aegilops tauschii. Nat Commun 13, 3044.
[18]	Ling HQ, Ma B, Shi XL, Liu H, Dong LL, Sun H, Cao YH, Gao Q, Zheng SS, Li Y, Yu Y, Du HL, Qi M, Li Y, Lu H, Yu HW, Cui Y, Wang N, Chen CL, Wu HL, Zhao Y, Zhang JC, Li YW, Zhou WJ, Zhang BR, Hu WJ, van Eijk MJT, Tang JF, Witsenboer HMA, Zhao SC, Li ZS, Zhang AM, Wang DW, Liang CZ (2018). Genome sequence of the progenitor of wheat A subgenome Triticum urartu. Nature 557, 424-428.
[19]	Mago R, Zhang P, Xia XD, Zhang JP, Hoxha S, Lagudah E, Graner A, Dundas I (2019). Transfer of stem rust resistance gene SrB from Thinopyrum ponticum into wheat and development of a closely linked PCR-based marker. Theor Appl Genet 132, 371-382.
[20]	Mapuranga J, Chang JY, Zhao JJ, Liang ML, Li RL, Wu YH, Zhang N, Zhang LR, Yang WX (2023). The underexplored mechanisms of wheat resistance to leaf rust. Plants (Basel) 12, 3996.
[21]	Niu Z, Klindworth DL, Yu G, Friesen TL, Chao S, Jin Y, Cai X, Ohm JB, Rasmussen JB, Xu SS (2014). Development and characterization of wheat lines carrying stem rust resistance gene Sr43 derived from Thinopyrum ponticum. Theor Appl Genet 127, 969-980. DOI PMID
[22]	Peto FH (1936). Hybridization of Triticum and Agropyron. II. Cytology of the male parents and F₁ generation. Can J Res 14c, 203-214.
[23]	Pirseyedi SM, Somo M, Poudel RS, Cai XW, McCallum B, Saville B, Fetch T, Chao SAM, Marais F (2015). Characterization of recombinants of the Aegilops peregrina-derived Lr59 translocation of common wheat. Theor Appl Genet 128, 2403-2414.
[24]	Prasad P, Savadi S, Bhardwaj SC, Gupta PK (2020). The progress of leaf rust research in wheat. Fungal Biol 124, 537-550.
[25]	Reynolds M, Foulkes J, Furbank R, Griffiths S, King J, Murchie E, Parry M, Slafer G (2012). Achieving yield gains in wheat. Plant Cell Environ 35, 1799-1823.
[26]	Roelfs AP, Singh RP, Saari EE (1992). Rust Diseases of Wheat: Concepts and Methods of Disease Management. Mexico: CIMMYT. pp. 7-14.
[27]	Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW (1984). Ribosomal DNA spacer-length polymorphisms in barley: mendelian inheritance, chromosomal location, and population dynamics. Proc Natl Acad Sci USA 81, 8014-8018. DOI PMID
[28]	Sears ER (1973). Agropyron -wheat transfers induced by homoeologous pairing. In:Proceedings of the Fourth International Wheat Genetics Symposium Alien Genetic Material. pp.191-199.
[29]	Sears ER (1977). Analysis of wheat-Agropyron recombinant chromosomes. In:Proceedings of the 8th Eucarpia Congress. pp. 63-72.
[30]	Sharma D, Knott DR (1966). The transfer of leaf-rust resistance from Agropyron to Triticum by irradiation. Can J Genet Cytol 8, 137-143.
[31]	Singh A, Pallavi JK, Gupta P, Prabhu KV (2012). Identification of microsatellite markers linked to leaf rust resistance gene Lr25 in wheat. J Appl Genet 53, 19-25.
[32]	Singh RP, Singh PK, Rutkoski J, Hodson DP, He XY, Jørgensen LN, Hovmøller MS, Huerta-Espino J (2016). Disease impact on wheat yield potential and prospects of genetic control. Annu Rev Phytopathol 54, 303-322. DOI PMID
[33]	Smith EL, Schlehuber AM, Young HC Jr, Edwards LH (1968). Registration of agent wheat (reg. no. 471). Crop Sci 8, 511-512.
[34]	Tar M, Purnhauser L, Csősz L, Mesterházy Á, Gyulai G (2002). Identification of molecular markers for an efficient leaf rust resistance gene (Lr29) in wheat. Acta Biol Szeged 46, 133-134.
[35]	Tripathi AD, Mishra R, Maurya KK, Singh RB, Wilson DW (2019). Estimates for world population and global food availability for global health. In: Singh RB, Watson RR, Takahashi T, eds. The Role of Functional Food Security in Global Health. London: Academic Press. pp. 3-24.
[36]	Tsitsin NV (1965). Remote hybridisation as a method of creating new species and varieties of plants. Euphytica 14, 326-330.
[37]	Wang K, Li MY, Hakonarson H (2010). ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res 38, 164. DOI PMID
[38]	Wang SW, Wang CY, Feng XB, Zhao JX, Deng PC, Wang YJ, Zhang H, Liu XL, Li TD, Chen CH, Wang BT, Ji WQ (2022). Molecular cytogenetics and development of St-chromosome-specific molecular markers of novel stripe rust resistant wheat-Thinopyrum intermedium and wheat- Thinopyrum ponticum substitution lines. BMC Plant Biol 22, 111.
[39]	Wang YZ, Cao Q, Zhang JJ, Wang SW, Chen CH, Wang CY, Zhang H, Wang YJ, Ji WQ (2020). Cytogenetic analysis and molecular marker development for a new wheat-Thinopyrum ponticum 1J^S (1D) disomic substitution line with resistance to stripe rust and powdery mildew. Front Plant Sci 11, 1282.
[40]	Xu SS, Lyu ZF, Zhang N, Li MZ, Wei XY, Gao YH, Cheng XX, Ge WY, Li XF, Bao YG, Yang ZJ, Ma X, Wang HW, Kong LR (2023). Genetic mapping of the wheat leaf rust resistance gene Lr19 and development of translocation lines to break its linkage with yellow pigment. Theor Appl Genet 136, 200.
[41]	Yang GT, Deng PC, Ji WQ, Fu SL, Li HW, Li B, Li ZS, Zheng Q (2023a). Physical mapping of a new powdery mildew resistance locus from Thinopyrum ponticum chromosome 4AgS. Front Plant Sci 14, 1131205.
[42]	Yang GT, Zhang N, Boshoff WHP, Li HW, Li B, Li ZS, Zheng Q (2023b). Identification and introgression of a novel leaf rust resistance gene from Thinopyrum intermedium chromosome 7J^S into wheat. Theor Appl Genet 136, 231.
[43]	Zhang JL, Jie YZ, Yan LJ, Wang MM, Dong YL, Pang YF, Ren CC, Song J, Chen XD, Li XJ, Zhang PP, Yang DY, Zhang Y, Qi ZJ, Ru ZG (2024). Development and identification of a novel wheat-Thinopyrum ponticum disomic substitution line DS5Ag(5D) with new genes conferring resistance to powdery mildew and leaf rust. BMC Plant Biol 24, 718.
[44]	Zhang L, Shi CC, Li LR, Li M, Meng QF, Yan HF, Liu DQ (2020). Race and virulence analysis of Puccinia triticina in China in 2014 and 2015. Plant Dis 104, 455-464. DOI PMID
[45]	Zhang WJ, Lukaszewski AJ, Kolmer J, Soria MA, Goyal S, Dubcovsky J (2005). Molecular characterization of durum and common wheat recombinant lines carrying leaf rust resistance (Lr19 (Lr19) and yellow pigment (Y) genes from Lophopyrum ponticum. Theor Appl Genet 111, 573-582.
[46]	Zhang XY, Dong YS, Wang RRC (1996). Characterization of genomes and chromosomes in partial amphiploids of the hybrid Triticum aestivum × Thinopyrum ponticum by in situ hybridization, isozyme analysis, and RAPD. Genome 39, 1062-1071. DOI PMID
[47]	Zhao GY, Zou C, Li K, Wang K, Li TB, Gao LF, Zhang XX, Wang HJ, Yang ZJ, Liu X, Jiang WK, Mao L, Kong XY, Jiao YN, Jia JZ (2017). The Aegilops tauschii genome reveals multiple impacts of transposons. Nat Plants 3, 946-955.
[48]	Zhou JM (2020). Fighting Fusarium head blight in wheat—a remedy from afar. Chin Bull Bot 55, 123-125. (in Chinese)
	周俭民 (2020). 小麦抗赤霉病利器——他山之石. 植物学报 55, 123-125. DOI
[49]	Zhu C, Wang YZ, Chen CH, Wang CY, Zhang AC, Peng NN, Wang YJ, Zhang H, Liu XL, Ji WQ (2017). Molecular cytogenetic identification of a wheat-Thinopyrum ponticum substitution line with stripe rust resistance. Genome 60, 860-867. DOI PMID