Chinese Bulletin of Botany ›› 2024, Vol. 59 ›› Issue (3): 373-382.DOI: 10.11983/CBB23140 cstr: 32102.14.CBB23140
• RESEARCH PAPERS • Previous Articles Next Articles
Jixuan Yang, Xuefei Wang, Hongya Gu*(
)
Received:2023-10-15
Accepted:2024-01-02
Online:2024-05-10
Published:2024-05-10
Contact:
E-mail: Jixuan Yang, Xuefei Wang, Hongya Gu. Genetic Basis of Flowering Time Variations in Tibetan Arabidopsis thaliana[J]. Chinese Bulletin of Botany, 2024, 59(3): 373-382.
| Ecotype and transgenic plant | Source |
|---|---|
| Col-0 | Arabidopsis Biological Resource Center |
| Lhasa | Collected from Lhasa, Tibet |
| Dagze | Collected from Dagze, Tibet |
| JXnfx | Collected from Nanfeng, Jiangxi |
| SXcgx | Collected from Chenggu, Shaanxi |
| CQtlx | Collected from Tongliang, Chongqing |
| flc-/- (Lhasa) | Constructed by this experiment |
Table 1 Plant materials used in this study
| Ecotype and transgenic plant | Source |
|---|---|
| Col-0 | Arabidopsis Biological Resource Center |
| Lhasa | Collected from Lhasa, Tibet |
| Dagze | Collected from Dagze, Tibet |
| JXnfx | Collected from Nanfeng, Jiangxi |
| SXcgx | Collected from Chenggu, Shaanxi |
| CQtlx | Collected from Tongliang, Chongqing |
| flc-/- (Lhasa) | Constructed by this experiment |
| Primer name | Primer sequence (5′-3′) |
|---|---|
| DT1-FLC-BsF | ATATATGGTCTCGATTGCCTTCTCCAAACGTCGCAAGTT |
| DT1-FLC-BsR | ATTATTGGTCTCGAAACCCGGCGATAAGTACGCCTTC |
| DT1-FLC-F0 | TGCCTTCTCCAAACGTCGCAAGTTTTAGAGCTAGAAATAGC |
| DT1-FLC-R0 | AACCCGGCGATAAGTACGCCTTCAATCTCTTAGTCGACTCTAC |
| FLC-RT-F | AACGTCGCAACGGTCTCA |
| FLC-RT-R | TCCCACAAGCTTGCTATCCA |
| TUB2-RT-F | GTTCTCGATGTTGTTCGTAAG |
| TUB2-RT-R | TGTAAGGCTCAACCACAGTAT |
Table 2 Primers used in this study
| Primer name | Primer sequence (5′-3′) |
|---|---|
| DT1-FLC-BsF | ATATATGGTCTCGATTGCCTTCTCCAAACGTCGCAAGTT |
| DT1-FLC-BsR | ATTATTGGTCTCGAAACCCGGCGATAAGTACGCCTTC |
| DT1-FLC-F0 | TGCCTTCTCCAAACGTCGCAAGTTTTAGAGCTAGAAATAGC |
| DT1-FLC-R0 | AACCCGGCGATAAGTACGCCTTCAATCTCTTAGTCGACTCTAC |
| FLC-RT-F | AACGTCGCAACGGTCTCA |
| FLC-RT-R | TCCCACAAGCTTGCTATCCA |
| TUB2-RT-F | GTTCTCGATGTTGTTCGTAAG |
| TUB2-RT-R | TGTAAGGCTCAACCACAGTAT |
Figure 1 Statistic analyses on the flowering time and number of rosette leaves of Tibetan and other Arabidopsis populations (A) Flowering time of Col-0 and some Chinese wild populations (n≥40); (B) Number of rosette leaves at flowering (n≥40); (C) Correlation analysis between flowering time and number of rosette leaves. *** P<0.001 (Student’s t-test).
Figure 2 Frequency distribution of flowering time, QTL-seq mapping result in the F2 population and FLC gene sequence variation (A) Frequency distribution of flowering time in the F2 population; (B) QTL mapping result in the F2 population; (C) Variation in FLC of Tibetan Arabidopsis thaliana, black square indicates exon, and black line indicates intron. The genome-wide false discovery rate of 0.01 is indicated by the red line in Figure B. In Figure C, VRE indicates vernalization response element, and the dashed line indicates the deletion sequence in the Tibetan population.
| Population | Flowering time | Observed | Expected | χ2 | P-value |
|---|---|---|---|---|---|
| Lhasa-F2 | Early (<26 days) | 428 | 432 | 0.15 | 0.70 |
| Late (≥27 days) | 148 | 144 | |||
| Total | 576 | 576 |
Table 3 Chi-square test for the distribution of flowering time in F2 populations
| Population | Flowering time | Observed | Expected | χ2 | P-value |
|---|---|---|---|---|---|
| Lhasa-F2 | Early (<26 days) | 428 | 432 | 0.15 | 0.70 |
| Late (≥27 days) | 148 | 144 | |||
| Total | 576 | 576 |
Figure 3 Variation in the first intron of FLC in some Arabidopsis populations (modified from Michaels et al., 2003; Strange et al., 2011; Méndez-Vigo et al., 2016) FLC gene of Col-0 as a reference, black rectangle indicates exon, and black line indicates intron, red line indicates sequence deletion, and gray rectangle indicates sequence insertion.
Figure 4 Flowering phenotypes of Lhasa population and flc-/- (Lhasa) mutants, FLC expression pattern, and sequence variation of flc-/- (Lhasa) (A) Relative expression levels of FLC at different development stages in Col-0 and Lhasa population (veg1 and veg2 indicate the time of growing the 5th and 10th rosette leaves, respectively, and flr indicating the time of flowering); (B) Variant forms of DNA and amino acid sequences of Lhasa population and flc-/- (Lhasa) mutants (74 indicates the 74th base from ATG, red sequence indicates the amino acid sequence of flc-/- (Lhasa) mutants, red arrow indicates site where amino acid begin to change in the flc-/- (Lhasa) mutants and black box indicates the termination site in flc-/- (Lhasa) mutants); (C) Flowering phenotypes of Lhasa population and flc-/- (Lhasa) mutants (bar=2 cm), photographed 25 d after seedling transplantation; (D) Flowering time and number of rosette leaves at flowering in Lhasa population and flc-/- (Lhasa) mutants (n≥40). *** P<0.001 (Student’s t-test).
| [1] | Adamczyk BJ, Lehti-Shiu MD, Fernandez DE (2007). The MADS domain factors AGL15 and AGL18 act redundantly as repressors of the floral transition in Arabidopsis. Plant J 50, 1007-1019. |
| [2] | Angel A, Song J, Dean C, Howard M (2011). A polycomb- based switch underlying quantitative epigenetic memory. Nature 476, 105-108. |
| [3] | Angel A, Song J, Yang HC, Questa JI, Dean C, Howard M (2015). Vernalizing cold is registered digitally at FLC. Proc Natl Acad Sci USA 112, 4146-4151. |
| [4] | Berry S, Hartley M, Olsson TSG, Dean C, Howard M (2015). Local chromatin environment of a polycomb target gene instructs its own epigenetic inheritance. eLife 4, e07205. |
| [5] | Choi K, Kim J, Hwang HJ, Kim S, Park C, Kim SY, Lee I (2011). The FRIGIDA complex activates transcription of FLC, a strong flowering repressor in Arabidopsis, by recruiting chromatin modification factors. Plant Cell 23, 289-303. |
| [6] |
Crevillén P, Dean C (2011). Regulation of the floral repressor gene FLC: the complexity of transcription in a chromatin context. Curr Opin Plant Biol 14, 38-44.
DOI PMID |
| [7] | DeLeo VL, Menge DNL, Hanks EM, Juenger TE, Lasky JR (2020). Effects of two centuries of global environmental variation on phenology and physiology of Arabidopsis thaliana. Glob Change Biol 26, 523-538. |
| [8] | Ellis TJ, Postma FM, Oakley CG, Ågren J (2021). Life-history trade-offs and the genetic basis of fitness in Arabidopsis thaliana. Mol Ecol 30, 2846-2858. |
| [9] |
He F, Kang D, Ren Y, Qu LJ, Zhen Y, Gu H (2007). Genetic diversity of the natural populations of Arabidopsis thaliana in China. Heredity 99, 423-431.
PMID |
| [10] |
Heo JB, Sung S (2011). Vernalization-mediated epigenetic silencing by a long intronic noncoding RNA. Science 331, 76-79.
DOI PMID |
| [11] | Hepworth J, Antoniou-Kourounioti RL, Berggren K, Selga C, Tudor EH, Yates B, Cox D, Collier Harris BR, Irwin JA, Howard M, Säll T, Holm S, Dean C (2020). Natural variation in autumn expression is the major adaptive determinant distinguishing Arabidopsis FLC haplotypes. eLife 9, e57671. |
| [12] | Jiang DH, Gu XF, He YH (2009). Establishment of the winte- rannual growth habit via FRIGIDA-mediated histone methylation at FLOWERING LOCUS C in Arabidopsis. Plant Cell 21, 1733-1746. |
| [13] |
Johanson U, West J, Lister C, Michaels S, Amasino R, Dean C (2000). Molecular analysis of FRIGIDA, a major determinant of natural variation in Arabidopsis flowering time. Science 290, 344-347.
DOI PMID |
| [14] | Jung JH, Lee HJ, Ryu JY, Park CM (2016). SPL3/4/5 integrate developmental aging and photoperiodic signals into the FT-FD module in Arabidopsis flowering. Mol Plant 9, 1647-1659. |
| [15] | Kim DH, Sung S (2017). Vernalization-triggered intragenic chromatin loop formation by long noncoding RNAs. Dev Cell 40, 302-312. |
| [16] |
Kinoshita A, Richter R (2020). Genetic and molecular basis of floral induction in Arabidopsis thaliana. J Exp Bot 71, 2490-2504.
DOI PMID |
| [17] | Koornneef M, Hanhart CJ, van der Veen JH (1991). A genetic and physiological analysis of late flowering mutants in Arabidopsis thaliana. Mol Gen Genet 229, 57-66. |
| [18] | Krämer U (2015). Planting molecular functions in an ecological context with Arabidopsis thaliana. eLife 4, e06100. |
| [19] | Le Corre V, Roux F, Reboud X (2002). DNA polymorphism at the FRIGIDA gene in Arabidopsis thaliana: extensive nonsynonymous variation is consistent with local selection for flowering time. Mol Biol Evol 19, 1261-1271. |
| [20] | Lee I, Bleecker A, Amasino R (1993). Analysis of naturally occurring late flowering in Arabidopsis thaliana. Mol Gen Genet 237, 171-176. |
| [21] |
Li H, Durbin R (2009). Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760.
DOI PMID |
| [22] | Li PJ, Filiault D, Box MS, Kerdaffrec E, van Oosterhout C, Wilczek AM, Schmitt J, McMullan M, Bergelson J, Nordborg M, Dean C (2014). Multiple FLC haplotypes defined by independent cis-regulatory variation underpin life history diversity in Arabidopsis thaliana. Genes Dev 28, 1635-1640. |
| [23] | Liu ZW, Zhao N, Su YN, Chen SS, He XJ (2020). Exogenously overexpressed intronic long noncoding RNAs activate host gene expression by affecting histone modification in Arabidopsis. Sci Rep 10, 3094. |
| [24] | Mansfeld BN, Grumet R (2018). QTLseqr: an R package for bulk segregant analysis with next-generation sequencing. Plant Genome 11, 180006. |
| [25] |
Marquardt S, Boss PK, Hadfield J, Dean C (2006). Additional targets of the Arabidopsis autonomous pathway members, FCA and FY. J Exp Bot 57, 3379-3386.
DOI PMID |
| [26] |
Martínez-Berdeja A, Stitzer MC, Taylor MA, Okada M, Ezcurra E, Runcie DE, Schmitt J (2020). Functional variants of DOG1 control seed chilling responses and variation in seasonal life-history strategies in Arabidopsis thaliana. Proc Natl Acad Sci USA 117, 2526-2534.
DOI PMID |
| [27] |
McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, DePristo MA (2010). The genome analysis toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20, 1297-1303.
DOI PMID |
| [28] | Méndez-Vigo B, Picó FX, Ramiro M, Martínez-Zapater JM, Alonso-Blanco C (2011). Altitudinal and climatic adaptation is mediated by flowering traits and FRI, FLC, and PHYC genes in Arabidopsis. Plant Physiol 157, 1942-1955. |
| [29] | Méndez-Vigo B, Savic M, Ausín I, Ramiro M, Martín B, Picó FX, Alonso-Blanco C (2016). Environmental and genetic interactions reveal FLOWERING LOCUS C as a modulator of the natural variation for the plasticity of flowering in Arabidopsis. Plant Cell Environ 39, 282-294. |
| [30] |
Michaels SD, He YH, Scortecci KC, Amasino RM (2003). Attenuation of FLOWERING LOCUS C activity as a mechanism for the evolution of summer-annual flowering behavior in Arabidopsis. Proc Natl Acad Sci USA 100, 10102-10107.
PMID |
| [31] | Mitchell-Olds T, Schmitt J (2006). Genetic mechanisms and evolutionary significance of natural variation in Arabidopsis. Nature 441, 947-952. |
| [32] |
Putterill J, Robson F, Lee K, Simon R, Coupland G (1995). The CONSTANS gene of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc finger transcription factors. Cell 80, 847-857.
DOI PMID |
| [33] | Shindo C, Aranzana MJ, Lister C, Baxter C, Nicholls C, Nordborg M, Dean C (2005). Role of FRIGIDA and FLOWERING LOCUS C in determining variation in flowering time of Arabidopsis. Plant Physiol 138, 1163-1173. |
| [34] | Shindo C, Bernasconi G, Hardtke CS (2007). Natural genetic variation in Arabidopsis: tools, traits and prospects for evolutionary ecology. Ann Bot 99, 1043-1054. |
| [35] | Springthorpe V, Penfield S (2015). Flowering time and seed dormancy control use external coincidence to generate life history strategy. eLife 4, e05557. |
| [36] | Strange A, Li PJ, Lister C, Anderson J, Warthmann N, Shindo C, Irwin J, Nordborg M, Dean C (2011). Majo- reffect alleles at relatively few loci underlie distinct vernalization and flowering variation in Arabidopsis accessions. PLoS One 6, e19949. |
| [37] | Sung S, He YH, Eshoo TW, Tamada Y, Johnson L, Nakahigashi K, Goto K, Jacobsen SE, Amasino RM (2006). Epigenetic maintenance of the vernalized state in Arabidopsis thaliana requires LIKE HETEROCHROMATIN PROTEIN 1. Nat Genet 38, 706-710. |
| [38] | Takagi H, Abe A, Yoshida K, Kosugi S, Natsume S, Mitsuoka C, Uemura A, Utsushi H, Tamiru M, Takuno S, Innan H, Cano LM, Kamoun S, Terauchi R (2013). QTL- seq: rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations. Plant J 74, 174-183. |
| [39] | The 1001 Genomes Consortium (2016). 1,135 genomes reveal the global pattern of polymorphism in Arabidopsis thaliana. Cell 166, 481-491. |
| [40] | Xie YR, Zhou Q, Zhao YP, Li QQ, Liu Y, Ma MD, Wang BB, Shen RX, Zheng ZG, Wang HY (2020). FHY3 and FAR1 integrate light signals with the miR156-SPL module-mediated aging pathway to regulate Arabidopsis flowering. Mol Plant 13, 483-498. |
| [41] | Xu XR, Xu JY, Yuan C, Chen QQ, Liu QG, Wang XM, Qin C (2022). BBX17 interacts with CO and negatively regulates flowering time in Arabidopsis thaliana. Plant Cell Physiol 63, 401-409. |
| [42] | Yin P, Kang JQ, He F, Qu LJ, Gu HY (2010). The origin of populations of Arabidopsis thaliana in China, based on the chloroplast DNA sequences. BMC Plant Biol 10, 22. |
| [43] | Zan YJ, Carlborg Ö (2019). A polygenic genetic architecture of flowering time in the worldwide Arabidopsis thaliana population. Mol Biol Evol 36, 141-154. |
| [44] | Zeng LY, Gu ZY, Xu M, Zhao N, Zhu WD, Yonezawa T, Liu TM, Qiong L, Tersing T, Xu LL, Zhang Y, Xu RY, Sun NY, Huang YY, Lei JK, Zhang L, Xie F, Zhang F, Gu HY, Geng YP, Hasegawa M, Yang ZH, Crabbe MJC, Chen F, Zhong Y (2017). Discovery of a high-altitude ecotype and ancient lineage of Arabidopsis thaliana from Tibet. Sci Bull 62, 1628-1630. |
| [45] | Zhang YN, Zhou YP, Chen QH, Huang XL, Tian CE (2014). Molecular basis of flowering time regulation in Arabidopsis. Chin Bull Bot 49, 469-482. (in Chinese) |
|
张艺能, 周玉萍, 陈琼华, 黄小玲, 田长恩 (2014). 拟南芥开花时间调控的分子基础. 植物学报 49, 469-482.
DOI |
|
| [46] | Zhu P, Lister C, Dean C (2021). Cold-induced Arabidopsis FRIGIDA nuclear condensates for FLC repression. Nature 599, 657-661. |
| [47] | Zou YP, Hou XH, Wu Q, Chen JF, Li ZW, Han TS, Niu XM, Yang L, Xu YC, Zhang J, Zhang FM, Tan DY, Tian ZX, Gu HY, Guo YL (2017). Adaptation of Arabidopsis thaliana to the Yangtze River basin. Genome Biol 18, 239. |
| [1] | Yufan Niu, Lingling Chen, Chen Su, Lei Wang. Florigen FT: A Signaling Hub Connecting Environmental Cues and Developmental Regulation [J]. Chinese Bulletin of Botany, 2026, 61(1): 1-8. |
| [2] | Tingting Sun, Yanwen Zhang. Research progress on pollen dimorphism [J]. Biodiv Sci, 2025, 33(7): 25031-. |
| [3] | Zhaoyang Jing, Keguang Cheng, Heng Shu, Yongpeng Ma, Pingli Liu. Whole genome resequencing approach for conservation biology of endangered plants [J]. Biodiv Sci, 2023, 31(5): 22679-. |
| [4] | Ting Wang, Zengqiang Xia, Jiangping Shu, Jiao Zhang, Meina Wang, Jianbing Chen, Kanglin Wang, Jianying Xiang, Yuehong Yan. Dating whole-genome duplication reveals the evolutionary retardation of Angiopteris [J]. Biodiv Sci, 2021, 29(6): 722-734. |
| [5] | Changsheng Zhang, Tao Wei, Yuping Zhou, Tian Fan, Tianxiao Lü, Chang'en Tian. Progress in Flowering Regulation Mechanisms of FLC [J]. Chinese Bulletin of Botany, 2021, 56(6): 651-663. |
| [6] | Xiaofeng Yang, Xiaomeng Li, Wanjin Liao. Advances in the genetic regulating pathways of plant flowering time [J]. Biodiv Sci, 2021, 29(6): 825-842. |
| [7] | Meng Wang, Ting Wang, Zengqiang Xia, Tingzhang Li, Xiaohua Jin, Yuehong Yan, Jianbing Chen. Revealing the New Whole-genome Duplication Event of Four Paphiopedilum Species Based on Transcriptome Data [J]. Chinese Bulletin of Botany, 2021, 56(6): 699-714. |
| [8] | Simiao Sun, Jixin Chen, Weiwei Feng, Chang Zhang, Kai Huang, Ming Guan, Jiankun Sun, Mingchao Liu, Yulong Feng. Plant strategies for nitrogen acquisition and their effects on exotic plant invasions [J]. Biodiv Sci, 2021, 29(1): 72-80. |
| [9] | TAN Ke, DONG Shu-Peng, LU Tao, ZHANG Ya-Jing, XU Shi-Tao, REN Ming-Xun. Diversity and evolution of samara in angiosperm [J]. Chin J Plan Ecolo, 2018, 42(8): 806-817. |
| [10] | Jun-Wei YE, Yang ZHANG, Xiao-Juan WANG. Phylogeographic breaks and the mechanisms of their formation in the Sino-Japanese floristic region [J]. Chin J Plan Ecolo, 2017, 41(9): 1003-1019. |
| [11] | Lin Li, Ningna Lu, Baoli Fan, Zhigang Zhao. Effect of flowering time on floral sexual durations and phenotypic gender in dichogamous Aconitum gymnandrum [J]. Biodiv Sci, 2016, 24(6): 665-671. |
| [12] | Zhenna Qian, Qianwan Meng, Mingxun Ren. Pollination ecotypes and herkogamy variation of Hiptage benghalensis (Malpighiaceae) with mirror-image flowers [J]. Biodiv Sci, 2016, 24(12): 1364-1372. |
| [13] | Zhenna Qian, Mingxun Ren. Floral evolution and pollination shifts of the “Malpighiaceae route” taxa, a classical model for biogeographical study [J]. Biodiv Sci, 2016, 24(1): 95-101. |
| [14] | HUANG Yan-Bo,WEI Yu-Kun,WANG Qi,XIAO Yue-E,YE Xi-Yang. Floral morphology and pollination mechanism of Salvia liguliloba, a narrow endemic species with degraded lever-like stamens [J]. Chin J Plan Ecolo, 2015, 39(7): 753-761. |
| [15] | Yineng Zhang, Yuping Zhou, Qionghua Chen, Xiaoling Huang, Chang’en Tian. Molecular Basis of Flowering Time Regulation in Arabidopsis [J]. Chinese Bulletin of Botany, 2014, 49(4): 469-482. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||