Chin Bull Bot ›› 2016, Vol. 51 ›› Issue (5): 586-593.doi: 10.11983/CBB15223

Previous Articles     Next Articles

Indole Acetic Acid-Amido Synthetase GH3-6 Negatively Regulates Response to Drought and Salt in Arabidopsis

Xiaodong Liu1, Ruozhong Wang2, Binbin Jiao3, Peihong Dai1, Yue Li1*   

  1. 1College of Agronomy, Xinjiang Agricultural University, Urumqi 830052, China
    2Hunan Provincial Key Laboratory of Phytohormones and Growth Development, Hunan Agricultural University, Changsha 410128, China
    3Shanghai Entry-Exit Inspection and Quarantine Bureau, Shanghai 200135, China
  • Received:2015-12-22 Accepted:2016-04-26 Online:2016-09-27 Published:2016-09-01
  • Contact: Li Yue E-mail:liyue6905@126.com
  • About author:

    # Co-first authors

Abstract:

Auxin is an important phytohormone involved in almost all aspects of plant life. GH3-6 encodes a protein possessing adenylation activity that can conjugate amino acid to indole acetic acid (IAA), which leads to temporarily or permanently inactive IAA. Here we investigated the role of GH3-6 in plant stress adaptation. The expression of GH3-6 was induced by drought, abscisic acid (ABA) and high salt. Compared with the wild type, transgenic plants with GH3-6 overexpression (named dfl1-D) were sensitive to drought and lost more water from detached rosette leaves. dfl1-D also exhibited hyporesistance to high salt. In addition, overexpression of GH3-6 inhibited the expression of stress-responsive genes, including RD22, KIN1, RD29A and DREB1A. The content of ABA was lower in dfl1-D than the wild type under drought treatment. Overexpression of GH3-6 negatively regulates stress resistance in Arabidopsis.

Table 1

Primers used in this study"

Primer name Primer sequence (5'-3')
ACTIN2F GCACCCTGTTCTTCTTACCG
ACTIN2R AACCCTCGTAGATTGGCACA
NCED3F CGGACGGAACTAAATCAC
NCED3R CATACAGGACCCTATCACG
RD22F TACAAAATCGCGGCGGCTGGG
RD22R AGCGGAACCGCGTAGACGGT
KIN1F GCCTTCCAAGCCGGTCAGAC
KIN1R TCCCGCCTGTTGTGCTCCAG
RD29AF ACGGCGGTTTAGGAGCTCCGTT
RD29AR TCTCCGTCAAATCCCGTCGGCA
DREB1AF CCAAGAAACCGGCGGGTCGT
DREB1AR GGGCTAAAGCGGCAACGTCG

Figure 1

GH3-6 was induced by drought, ABA and high salt in Arabidopsis and overexpressed in dfl1-D mutant (A) Semi-quantitative RT-PCR analysis of GH3-6 expression after drought, ABA and high salt treatment in 20-day-old Arabidopsis seedlings; (B) Semi-quantitative RT-PCR analysis of GH3-6 expression in 20-day-old seedlings of dfl1-D mutant"

Figure 2

Arabidopsis CH3-6 overexpression mutant dfl1-D exhibited hypersensitivity to drought 20-day-old Arabidopsis seedlings were subjected to drought treatment for 25 days and then rewatered. (A) Phenotype of Ler and dfl1-D under normal condition; (B) Phenotype of Ler and dfl1-D 2 days after rewatering; (C) Plant survival rate at 2 days after rewatering (** indicates significant differences at P<0.01); (D) Water loss of detached rosette leaves from 30-day-old Arabidopsis"

Figure 3

Arabidopsis CH3-6 overexpression mutant dfl1-D exhibited reduced resistance to high salt stress 7-day-old Arabidopsis seedlings were subjected to high salt treatment for 10 days. (A) Phenotype of Ler and dfl1-D 10 days after high salt treatment; (B) Survival rate at 10 days after high salt treatment, ** indicates significant differences at P<0.01"

Figure 4

Overexpression of GH3-6 attenuated the expression of stress-responsive genes"

Figure 5

Overexpression of GH3-6 inhibited ABA biosynthesis of Arabidopsis ABA contents of the detached rosette leaves from 30-day-old plants were determined at 0 h and 3 h after drought treatment. * and ** indicate significant differences at P<0.05 and P<0.01, respectively, compared with corresponding 0 h plants."

1 王若仲, 萧浪涛, 蔺万煌, 曹庸, 卜晓英 (2002). 亚种间杂交稻内源激素的高效液相色谱测定法. 色谱 20, 148-150.
2 Delker C, Raschke A, Quint M (2008). Auxin dynamics: the dazzling complexity of a small molecule’s message.Planta 227, 929-941.
3 Ding X, Cao Y, Huang L, Zhao J, Xu C, Li X, Wang S (2008). Activation of the indole-3-acetic acid-amido synthetase GH3-8 suppresses expansin expression and promotes salicylate- and jasmonate-independent basal immunity in rice.Plant Cell 20, 228-240.
4 Domingo C, Andrés F, Tharreau D, Iglesias DJ, Talón M (2009). Constitutive expression of OsGH3.1 reduces auxin content and enhances defense response and resistance to a fungal pathogen in rice.Mol Plant Microbe Interact 22, 201-210.
5 Du H, Wu N, Fu J, Wang S, Li X, Xiao J, Xiong L (2012). A GH3 family member, OsGH3-2, modulates auxin and abscisic acid levels and differentially affects drought and cold tolerance in rice.J Exp Bot 63, 6467-6480.
6 Feng S, Yue R, Tao S, Yang Y, Zhang L, Xu M, Wang H, Shen C (2015). Genome-wide identification, expression analysis of auxin-responsive GH3 family genes in maize (Zea mays L.) under abiotic stresses.J Integr Plant Biol 57, 783-795.
7 Fu J, Liu H, Li Y, Yu H, Li X, Xiao J, Wang S (2011). Manipulating broad-spectrum disease resistance by suppressing pathogen-induced auxin accumulation in rice.Plant Physiol 155, 589-602.
8 Iuchi S, Kobayashi M, Taji T, Naramoto M, Seki M, Kato T, Tabata S, Kakubari Y, Yamaguchi-Shinozaki K, Shinozaki K (2001). Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis.Plant J 27, 325-333.
9 Ke Q, Wang Z, Ji CY, Jeong JC, Lee HS, Li H, Xu B, Deng X, Kwak SS (2015). Transgenic poplar expressing Arabidopsis YUCCA6 exhibits auxin-overproduction phenotypes and increased tolerance to abiotic stress.Plant Physiol Biochem 94, 19-27.
10 Khan S, Stone J (2007). Arabidopsis thaliana GH3.9 influences primary root growth.Planta 226, 21-34.
11 Kim JI, Baek D, Park HC, Chun HJ, Oh DH, Lee MK, Cha JY, Kim WY, Kim MC, Chung WS, Bohnert HJ, Lee SY, Bressan RA, Lee SW, Yun DJ (2013). Overexpression of Arabidopsis YUCCA6 in potato results in high-auxin developmental phenotypes and enhanced resistance to water deficit.Mol Plant 6, 337-349.
12 Kraft M, Kuglitsch R, Kwiatkowski J, Frank M, Gross- mann K (2007). Indole-3-acetic acid and auxin herbicides up-regulate 9-cis-epoxycarotenoid dioxygenase gene expression and abscisic acid accumulation in cleavers (Galium aparine): interaction with ethylene.J Exp Bot 58, 1497-1503.
13 Nakazawa M, Yabe N, Ichikawa T, Yamamoto YY, Yoshizumi T, Hasunuma K, Matsui M (2001). DFL1, an auxin responsive GH3 gene homologue, negatively regu- lates shoot cell elongation and lateral root formation, and positively regulates the light response of hypocotyl length.Plant J 25, 213-221.
14 Okrent RA, Wildermuth MC (2011). Evolutionary history of the GH3 family of acyl adenylases in rosids.Plant Mol Biol 76, 489-505.
15 Pandey GK, Cheong YH, Kim KN, Grant JJ, Li L, Hung W, D'Angelo C, Weinl S, Kudla J, Luan S (2004). The calcium sensor calcineurin B-like 9 modulates abscisic acid sensitivity and biosynthesis in Arabidopsis.Plant Cell 16, 1912-1924.
16 Park JE, Park JY, Kim YS, Staswick PE, Jeon J, Yun J, Kim SY, Kim J, Lee YH, Park CM (2007). GH3-medi- ated auxin homeostasis links growth regulation with stress adaptation response in Arabidopsis.J Biol Chem 282, 10036-10046.
17 Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K (2002). DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression.Biochem Biophys Res Commun 290, 998-1009.
18 Shi H, Chen L, Ye T, Liu X, Ding K, Chan Z (2014). Modulation of auxin content in Arabidopsis confers improved drought stress resistance.Plant Physiol Biochem 82, 209-217.
19 Singh VK, Jain M, Garg R (2015). Genome-wide analysis and expression profiling suggest diverse roles of GH3 genes during development and abiotic stress responses in legumes.Front Plant Sci 5, 789.
20 Staswick PE, Serban B, Rowe M, Tiryaki I, Maldonado MT, Maldonado MC, Suza W (2005). Characterization of an Arabidopsis enzyme family that conjugates amino acids to indole-3-acetic acid.Plant Cell 17, 616-627.
21 Staswick PE, Tiryaki I, Rowe ML (2002). Jasmonate response locus JAR1 and several related Arabidopsis genes encode enzymes of the fire?y luciferase superfamily that show activity on jasmonic, salicylic, and indole-3-acetic acids in an assay for adenylation.Plant Cell 14, 1405-1415.
22 Takase T, Nakazawa M, Ishikawa A, Kawashima M, Ichikawa T, Takahashi N, Shimada H, Manabe K, Matsui M (2004). ydk1-D, an auxin-responsive GH3 mutant that is involved in hypocotyl and root elongation.Plant J 37, 471-483.
23 Terol J, Domingo C, Talón M (2006). The GH3 family in plants: genome wide analysis in rice and evolutionary history based on EST analysis.Gene 371, 279-290.
24 Urano K, Maruyama K, Ogata Y, Morishita Y, Takeda M, Sakurai N, Suzuki H, Saito K, Shibata D, Kobayashi M, Yamaguchi-Shinozaki K, Shinozaki K (2009). Characterization of the ABA-regulated global responses to dehydration in Arabidopsis by metabolomics.Plant J 57, 1065-1078.
25 Woodward AW, Bartel B (2005). Auxin: regulation, action, and interaction.Annu Bot 95, 707-735.
26 Xia K, Wang R, Ou X, Fang Z, Tian C, Duan J, Wang Y, Zhang M (2012). OsTIR1 and OsAFB2 downregulation via OsmiR393 overexpression leads to more tillers, early flowering and less tolerance to salt and drought in rice.PLoS One 7, e30039.
27 Xiong L, Ishitani M, Lee H, Zhu JK (2001). The Arabidopsis LOS5/ABA3 locus encodes a molybdenum cofactor sulfurase and modulates cold stress- and osmotic stress- responsive gene expression.Plant Cell 13, 2063-2083.
28 Xiong L, Zhu JK (2013). Regulation of abscisic acid biosynthesis.Plant Physiol 133, 29-36.
29 Zhang SW, Li CH, Cao J, Zhang YC, Zhang SQ, Xia YF, Sun DY, Sun Y (2009). Altered architecture and enhanced drought tolerance in rice via the down-regulation of indole-3-acetic acid by TLD1/OsGH3.13 activation.Plant Physiol 151, 1889-1901.
30 Zhang Z, Li Q, Li Z, Staswick PE, Wang M, Zhu Y, He Z (2007). Dual regulation role of GH3.5 in salicylic acid and auxin signaling during Arabidopsis-Pseudomonas syringae interaction.Plant Physiol 145, 450-464.
31 Zhao Y (2010). Auxin biosynthesis and its role in plant development.Annu Rev Plant Biol 61, 49-64.
No related articles found!
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
[1] Zhang Zhen-jue. Some Principles Governing Shedding of Flowers and Fruits in Vanilla fragrans[J]. Chin Bull Bot, 1985, 3(05): 36 -37 .
[2] Qian Gao;Yuying Liu;Yinan Fei;Dapeng Li;Xianglin Liu* . Research Advances into the Root Radial Patterning Gene SHORT-ROOT[J]. Chin Bull Bot, 2008, 25(03): 363 -372 .
[3] Wang Bao-shan;Zou Qi and Zhao Ke-fu. Advances in Mechanism of Crop Salt Tolerance and Strategies for Raising Crop Salt Tolerance[J]. Chin Bull Bot, 1997, 14(增刊): 25 -30 .
[4] HE Feng WU Zhen-Bin. Application of Aquatic Plants in Sewage Treatment and Water Quality Improvement[J]. Chin Bull Bot, 2003, 20(06): 641 -647 .
[5] ZHANG Yan FANG Li LI Tian-Fei YAO Zhao-BingJIANG Jin-Hui. Effect of Calcium on the Heat Tolerance and Active Oxygen Metabolism of Tobacco Leaves[J]. Chin Bull Bot, 2002, 19(06): 721 -726 .
[6] JIA Hu-Sen LI De-QuanHAN Ya-Qin. Cytochrome b-559 in Chloroplasts[J]. Chin Bull Bot, 2001, 18(02): 158 -162 .
[7] Wei Sun;Chonghui Li;Liangsheng Wang;Silan Dai*. Analysis of Anthocyanins and Flavones in Different-colored Flowers of Chrysanthemum[J]. Chin Bull Bot, 2010, 45(03): 327 -336 .
[8] . Phosphate_Stress Protein and Iron_Stress Protein in Plants[J]. Chin Bull Bot, 2001, 18(05): 571 -576 .
[9] ZHANG Da-Yong, JIANG Xin-Hua. An Ecological Perspective on Crop Prduction[J]. Chin J Plan Ecolo, 2000, 24(3): 383 -384 .
[10] Gui Ji-xun, Zhu Ting-cheng. Study of Energy Flow Between Litter and Decomposers in Aneurolepidium chinese Grassland[J]. Chin J Plan Ecolo, 1992, 16(2): 143 -148 .