Chinese Bulletin of Botany ›› 2019, Vol. 54 ›› Issue (2): 217-226.doi: 10.11983/CBB18222

;

• EXPERIMENTAL COMMUNICATIONS • Previous Articles     Next Articles

Effect of SmGGPPS2 Expression on Tanshinones Biosynthesis in Salvia miltiorrhiza

Hua Wenping1,2,Chen Chen3,4,Zhi Yuan2,Liu Li1,Wang Zhezhi2,Li Cuiqin2,*()   

  1. 1 Department of Life Sciences and Food Technology, Shaanxi Xueqian Normal University, Xi’an 710061, China
    2 Key Laboratory of Medicinal Resources and Natural Pharmaceutical Chemistry, Ministry of Education, National Engineering Laboratory for Resource Developing of Endangered Chinese Crude Drugs in Northwest of China, College of Life Sciences, Shaanxi Normal University, Xi’an 710062, China
    3 Xi’an Botanical Garden, Xi’an 710068, China
    4 Shaanxi Engineering Research Centre for Conservation and Utilization of Botanical Resources, Xi’an 710068, China
  • Received:2018-10-22 Accepted:2019-02-19 Online:2019-09-01 Published:2019-03-01
  • Contact: Li Cuiqin E-mail:licuiqin16@snnu.edu.cn

Abstract:

Geranylgerany pyrophosphate synthase (GGPPS) is an important regulator in the plant diterpenoid biosynthesis pathway. The GGPPS gene family plays a critical role in the development of the medicinal model plant Salvia miltiorrhiza. However, the biological function of SmGGPPS2, especially in the biosynthesis of tanshinone or other active ingredients, is still unclear. For functional investigation, SmGGPPS2 expression was up- or down-regulated in S. miltiorrhiza plants via overexpression or RNA interference, respectively. Then we detected the content of tanshinones, the expression of genes related to tanshinone biosynthesis, and the physiological indexes of transgenic S. miltiorrhiza plants. The content of fat-soluble components, such as tanshinone IIA and ferruginol, was increased significantly in SmGG- PPS2-overexpressed lines compared with the wild type, and the content of fat soluble-components was lower in SmGGPPS2-RNAi lines than those in the wild type lines. With the regulation of SmGGPPS2, the expression of key enzyme genes related to tanshinone biosynthesis in S. miltiorrhiza, such as SmHMGR1 and SmCPS1, was changed. In addition, the regulation of SmGGPPS2 expression also affected the resistance of S. miltiorrhiza. Our results indicate that SmGGPPS2 plays an important regulatory role in tanshinone biosynthesis.

Key words: Salvia miltiorrhiza, GGPPS, tanshinone, gene expression

Table 1

Primers used for vector construction and detection in this study"

Primer name Sequence (5′→3′)
OG2S (KpnI) GGGGTACCGCGAAGAGCGTGGAAGC- AGA
OG2R (BamHI) CGGGATCC GGCAATAGCAATCAAGGGAGCA
G2i1S (EcoRI) CGGAATTC CTCCTCTCAACCTCTGTCAAAACTC
G2i1R (KpnI) GGGGTACCTCATCTGGACCACTGCC- TCC
G2i2S (BamHI) CGGGATCC CTCCTCTCAACCTCTGTCAAAACTC
G2i2R (HindIII) CCCAAGCTTTCATCTGGACCACTGCC- TCC
35SF GCCGTGAAGACTGGCGAACA
35SR AGGAAGGGTCTTGCGAAGGATAGT

Table 2

Primers used for qPCR in this study"

Primer name Sequence (5′→3′) Primer name Sequence (5′→3′)
ActinS AGGAACCACCGATCCAGACA SmDXS1S TGAGAGCGACTACGACTGCTTTGG
ActinR GGTGCCCTGAGGTCCTGTT SmDXS1R CCCATCCAGATTGGCAGTAGGC
SmHMGR1S GCAACCATCTACTCTCGTCCCA SmDXS2S GGTCGAGGAACTGGAGGGATTG
SmHMGR1R GTGCTCCATGAGCTGCATCAG SmDXS2R CGTCAGGATTTCGTGCGGATA
SmHMGR2S GGGTTCAACTACGAGGCCATACTG SmDXS3S CACGAATGGGCTGCCAAAAT
SmHMGR2R TGTTTGTGCTCGCCACCAGG SmDXS3R CCATCGAATCCAATGAAGCCAC
SmHMGR3S AGTCTCGTGATGTCCCTGCTCG SmGGPPS1S GGGGCTATTTTGGGAGGTGGAA
SmHMGR3R GCCTCAACCTGCTTGGCGTA SmGGPPS1R CAGCAGCTTGGGATACGTGGTC
SmIPI1S AGCGTGCATCCAAATCCAGAC SmGGPPS2S CGGTCTCCTCTCAACCTCTGTCAA
SmIPI1R GATAGCTTCAAGCCCCCCTCA SmGGPPS2R CTCCTTCATCTGGACCACTGCCT
SmCPS1S ATGGATGGGCAGCAGCAGTAAA SmGGPPS3S GGCCAGTGCTCTGCTGTCTGTG
SmCPS1R CGTCCTCAACAACGTCCTGATGTATT SmGGPPS3R TCGGCCACCTCCATCGCTT

Figure 1

Phenotypes and PCR-screening of the transgenic lines of Salvia miltiorrhiza (A) SmGGPPS2-overexpression transgenic line (OG2-3), SmGGPPS2-RNAi transgenic line (IG2-6), and wild type (Bar= 2 cm); (B) SmGGPPS2-overexpression transgenic lines (1-13); (B) SmGGPPS2-RNAi transgenic lines (1-20). M: DNA marker DL2000; WT: Wild type; c: Negative control; p: Positive control"